Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0105 Transporter Info
Gene Name SLC16A14
Transporter Name Monocarboxylate transporter 14
Gene ID
151473
UniProt ID
Q7RTX9
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 5'UTR (cg24704015)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 4.93E-03; Z-score: 3.49E+00

Methylation in Case

 3.21E-01 (Median) Methylation in Control 2.97E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 TSS1500 (cg02637654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.35E+00 Statistic Test p-value: 9.64E-07; Z-score: -4.96E+00

Methylation in Case

 5.07E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 TSS1500 (cg25621735)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.26E-03; Z-score: -1.64E+00

Methylation in Case

 6.03E-01 (Median) Methylation in Control 6.63E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 TSS1500 (cg20822693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 8.75E-03; Z-score: -1.99E+00

Methylation in Case

 7.14E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 TSS200 (cg01172899)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.57E+00 Statistic Test p-value: 2.22E-04; Z-score: -2.90E+00

Methylation in Case

 1.58E-01 (Median) Methylation in Control 2.48E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 TSS200 (cg07490650)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.32E-02; Z-score: -1.24E+00

Methylation in Case

 4.66E-02 (Median) Methylation in Control 5.67E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 Body (cg01021245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 2.19E-04; Z-score: -3.77E+00

Methylation in Case

 7.59E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 Body (cg00542545)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.95E-04; Z-score: -5.06E+00

Methylation in Case

 9.48E-01 (Median) Methylation in Control 9.78E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 Body (cg21540962)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.48E-02; Z-score: -2.19E+00

Methylation in Case

 8.84E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 Body (cg20728704)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.49E-02; Z-score: -1.52E+00

Methylation in Case

 8.89E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC16A14 in bladder cancer [ 1 ]

Location

 3'UTR (cg10277956)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.09E+00 Statistic Test p-value: 2.49E-12; Z-score: -2.38E+01

Methylation in Case

 2.69E-01 (Median) Methylation in Control 8.32E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in clear cell renal cell carcinoma [ 2 ]

Location

 5'UTR (cg22945872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 2.01E-02; Z-score: 5.53E-01

Methylation in Case

 5.41E-02 (Median) Methylation in Control 5.01E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in clear cell renal cell carcinoma [ 2 ]

Location

 TSS1500 (cg02637654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.29E-09; Z-score: -2.55E+00

Methylation in Case

 7.87E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in clear cell renal cell carcinoma [ 2 ]

Location

 TSS200 (cg01172899)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.53E+00 Statistic Test p-value: 1.45E-05; Z-score: 2.38E+00

Methylation in Case

 3.73E-01 (Median) Methylation in Control 2.44E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in clear cell renal cell carcinoma [ 2 ]

Location

 TSS200 (cg13062396)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.34E+00 Statistic Test p-value: 1.77E-04; Z-score: 2.89E+00

Methylation in Case

 6.40E-02 (Median) Methylation in Control 2.74E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A14 in clear cell renal cell carcinoma [ 2 ]

Location

 TSS200 (cg07490650)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.47E+00 Statistic Test p-value: 2.21E-02; Z-score: 1.73E+00

Methylation in Case

 2.17E-02 (Median) Methylation in Control 1.48E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in colon adenocarcinoma [ 3 ]

Location

 5'UTR (cg07466705)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.36E+00 Statistic Test p-value: 7.28E-08; Z-score: 2.03E+00

Methylation in Case

 5.31E-01 (Median) Methylation in Control 3.90E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in colon adenocarcinoma [ 3 ]

Location

 TSS1500 (cg01178971)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 3.28E-03; Z-score: -1.65E+00

Methylation in Case

 3.72E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in colon adenocarcinoma [ 3 ]

Location

 TSS200 (cg10212705)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 7.32E+00 Statistic Test p-value: 5.03E-05; Z-score: 1.84E+01

Methylation in Case

 3.37E-01 (Median) Methylation in Control 4.61E-02 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in colon adenocarcinoma [ 3 ]

Location

 Body (cg00437173)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 9.44E-06; Z-score: -2.70E+00

Methylation in Case

 5.10E-01 (Median) Methylation in Control 6.01E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A14 in colon adenocarcinoma [ 3 ]

Location

 Body (cg19156231)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 2.96E-03; Z-score: 1.11E+00

Methylation in Case

 5.54E-01 (Median) Methylation in Control 4.83E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

          13 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 5'UTR (cg22945872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 5.29E-05; Z-score: 7.57E-01

Methylation in Case

 1.25E-01 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 5'UTR (cg24704015)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 4.43E-04; Z-score: 8.10E-01

Methylation in Case

 4.38E-01 (Median) Methylation in Control 4.08E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 5'UTR (cg26338195)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 6.06E-03; Z-score: 7.01E-02

Methylation in Case

 2.79E-02 (Median) Methylation in Control 2.72E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 5'UTR (cg02821501)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.07E-02; Z-score: 1.70E-01

Methylation in Case

 2.37E-02 (Median) Methylation in Control 2.28E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 5'UTR (cg00455164)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.09E-02; Z-score: -1.06E-01

Methylation in Case

 1.69E-02 (Median) Methylation in Control 1.78E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg20822693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 9.22E-05; Z-score: -1.01E+00

Methylation in Case

 7.91E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg02637654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.89E-03; Z-score: -7.85E-01

Methylation in Case

 8.03E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg25621735)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.86E-02; Z-score: -8.14E-01

Methylation in Case

 8.00E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 TSS200 (cg07490650)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.27E-02; Z-score: 1.56E-01

Methylation in Case

 9.15E-02 (Median) Methylation in Control 8.97E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 Body (cg01021245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.64E-04; Z-score: -1.33E+00

Methylation in Case

 9.21E-01 (Median) Methylation in Control 9.35E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 Body (cg00542545)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.89E-02; Z-score: -7.66E-01

Methylation in Case

 9.78E-01 (Median) Methylation in Control 9.81E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC16A14 in colorectal cancer [ 4 ]

Location

 3'UTR (cg10277956)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 5.51E-09; Z-score: -2.78E+00

Methylation in Case

 8.28E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          18 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg22945872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 1.45E-06; Z-score: 1.12E+00

Methylation in Case

 1.11E-01 (Median) Methylation in Control 9.21E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg26338195)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 1.09E-04; Z-score: 2.91E-01

Methylation in Case

 3.49E-02 (Median) Methylation in Control 3.11E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg00483994)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.76E-04; Z-score: -2.81E-01

Methylation in Case

 8.77E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg02821501)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.15E-03; Z-score: -6.09E-03

Methylation in Case

 3.60E-02 (Median) Methylation in Control 3.60E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg00455164)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 3.63E-03; Z-score: 1.30E-01

Methylation in Case

 2.77E-02 (Median) Methylation in Control 2.59E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg09067747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.13E-12; Z-score: -1.99E+00

Methylation in Case

 5.41E-01 (Median) Methylation in Control 6.03E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg25621735)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.99E-04; Z-score: -1.19E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg20822693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.06E-04; Z-score: -6.51E-01

Methylation in Case

 7.09E-01 (Median) Methylation in Control 7.55E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg02637654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.46E-04; Z-score: -1.75E-01

Methylation in Case

 6.83E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg07490650)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.58E+00 Statistic Test p-value: 7.09E-05; Z-score: 6.67E-01

Methylation in Case

 1.57E-01 (Median) Methylation in Control 9.95E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg13062396)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 8.83E-04; Z-score: 4.09E-01

Methylation in Case

 2.25E-01 (Median) Methylation in Control 1.87E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg01172899)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 9.67E-03; Z-score: 9.02E-01

Methylation in Case

 4.24E-01 (Median) Methylation in Control 3.52E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 13

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 1stExon (cg25177139)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.47E+00 Statistic Test p-value: 1.06E-17; Z-score: -7.76E+00

Methylation in Case

 5.89E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 14

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg16605633)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.48E+00 Statistic Test p-value: 5.26E-16; Z-score: -2.67E+00

Methylation in Case

 4.96E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 15

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg21540962)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 9.10E-06; Z-score: -1.59E+00

Methylation in Case

 8.50E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 16

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg00542545)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.02E-04; Z-score: -8.91E-01

Methylation in Case

 9.68E-01 (Median) Methylation in Control 9.76E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 17

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg20728704)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.35E-04; Z-score: -4.18E-01

Methylation in Case

 7.67E-01 (Median) Methylation in Control 8.20E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 18

 Methylation of SLC16A14 in hepatocellular carcinoma [ 5 ]

Location

 3'UTR (cg10277956)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.11E-07; Z-score: -1.60E+00

Methylation in Case

 6.74E-01 (Median) Methylation in Control 7.56E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in pancretic ductal adenocarcinoma [ 6 ]

Location

 5'UTR (cg04783530)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 4.55E-02; Z-score: -1.10E-02

Methylation in Case

 9.15E-01 (Median) Methylation in Control 9.15E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS1500 (cg24168914)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.20E-02; Z-score: 2.65E-02

Methylation in Case

 7.95E-02 (Median) Methylation in Control 7.84E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS1500 (cg05950509)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.66E-02; Z-score: -6.20E-01

Methylation in Case

 7.32E-01 (Median) Methylation in Control 7.74E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in pancretic ductal adenocarcinoma [ 6 ]

Location

 TSS200 (cg12307787)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.19E+00 Statistic Test p-value: 9.53E-21; Z-score: 3.47E+00

Methylation in Case

 2.56E-01 (Median) Methylation in Control 1.17E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A14 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg05686323)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 5.43E-03; Z-score: -8.57E-01

Methylation in Case

 7.00E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A14 in pancretic ductal adenocarcinoma [ 6 ]

Location

 Body (cg22022988)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 4.18E-02; Z-score: 6.57E-01

Methylation in Case

 8.95E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC16A14 in pancretic ductal adenocarcinoma [ 6 ]

Location

 3'UTR (cg11105927)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 9.01E-04; Z-score: 6.79E-01

Methylation in Case

 7.37E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in papillary thyroid cancer [ 7 ]

Location

 5'UTR (cg26338195)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.75E-02; Z-score: 7.24E-01

Methylation in Case

 8.02E-02 (Median) Methylation in Control 7.42E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg02637654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.86E-03; Z-score: -3.41E-01

Methylation in Case

 7.59E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in papillary thyroid cancer [ 7 ]

Location

 TSS200 (cg13062396)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 1.72E-03; Z-score: -3.81E-01

Methylation in Case

 8.49E-02 (Median) Methylation in Control 9.89E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in papillary thyroid cancer [ 7 ]

Location

 Body (cg00542545)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.94E-02; Z-score: -4.09E-01

Methylation in Case

 9.49E-01 (Median) Methylation in Control 9.52E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Breast cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in breast cancer [ 8 ]

Location

 TSS1500 (cg02637654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.16E-13; Z-score: -2.12E+00

Methylation in Case

 6.34E-01 (Median) Methylation in Control 7.18E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in breast cancer [ 8 ]

Location

 TSS200 (cg07490650)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 5.06E-03; Z-score: -6.80E-01

Methylation in Case

 5.89E-02 (Median) Methylation in Control 7.30E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in breast cancer [ 8 ]

Location

 TSS200 (cg01172899)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.93E-02; Z-score: -4.15E-01

Methylation in Case

 3.26E-01 (Median) Methylation in Control 3.44E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in breast cancer [ 8 ]

Location

 Body (cg01021245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.83E-02; Z-score: -4.83E-01

Methylation in Case

 8.36E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A14 in breast cancer [ 8 ]

Location

 3'UTR (cg10277956)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.07E-07; Z-score: -9.95E-01

Methylation in Case

 7.99E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg02637654)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 7.24E-04; Z-score: -3.15E+00

Methylation in Case

 6.52E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in lung adenocarcinoma [ 9 ]

Location

 TSS1500 (cg20822693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 8.62E-04; Z-score: -3.00E+00

Methylation in Case

 7.10E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in lung adenocarcinoma [ 9 ]

Location

 TSS200 (cg07490650)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 7.75E-03; Z-score: 2.44E+00

Methylation in Case

 1.02E-01 (Median) Methylation in Control 8.16E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in lung adenocarcinoma [ 9 ]

Location

 TSS200 (cg01172899)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 2.15E-02; Z-score: 1.75E+00

Methylation in Case

 4.01E-01 (Median) Methylation in Control 3.24E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A14 in lung adenocarcinoma [ 9 ]

Location

 Body (cg00542545)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.81E-03; Z-score: -1.78E+00

Methylation in Case

 9.64E-01 (Median) Methylation in Control 9.73E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC16A14 in lung adenocarcinoma [ 9 ]

Location

 3'UTR (cg10277956)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 3.21E-05; Z-score: 2.85E+00

Methylation in Case

 8.27E-01 (Median) Methylation in Control 7.10E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in panic disorder [ 10 ]

Location

 TSS1500 (cg20822693)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.32E-03; Z-score: 6.11E-01

Methylation in Case

 2.32E+00 (Median) Methylation in Control 2.05E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC16A14 in panic disorder [ 10 ]

Location

 TSS200 (cg01172899)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -8.97E-01 Statistic Test p-value: 4.33E-03; Z-score: -4.19E-01

Methylation in Case

 -2.53E+00 (Median) Methylation in Control -2.27E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC16A14 in panic disorder [ 10 ]

Location

 TSS200 (cg13062396)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.68E-01 Statistic Test p-value: 3.42E-02; Z-score: -2.93E-01

Methylation in Case

 -4.10E+00 (Median) Methylation in Control -3.97E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC16A14 in panic disorder [ 10 ]

Location

 Body (cg20728704)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 3.39E-02; Z-score: -5.10E-01

Methylation in Case

 1.20E+00 (Median) Methylation in Control 1.42E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC16A14 in panic disorder [ 10 ]

Location

 3'UTR (cg10277956)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.50E+00 Statistic Test p-value: 2.85E-02; Z-score: -4.76E-01

Methylation in Case

 -3.80E-02 (Median) Methylation in Control 1.33E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC16A14 in prostate cancer [ 11 ]

Location

 TSS1500 (cg27150460)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.73E+00 Statistic Test p-value: 1.11E-02; Z-score: 8.30E+00

Methylation in Case

 5.60E-01 (Median) Methylation in Control 3.23E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Prostate cancer metastasis

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC16A14 in prostate cancer metastasis than that in healthy individual

Studied Phenotype

 Prostate cancer metastasis [ICD-11:2.00E+06]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.001153954; Fold-change: -0.260925205; Z-score: -16.68181543
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

          15 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7a directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7a miRNA Mature ID let-7a-3p

miRNA Sequence

 CUAUACAAUCUACUGUCUUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 let-7b directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-3p

miRNA Sequence

 CUAUACAACCUACUGCCUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 let-7f-1 directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7f-1 miRNA Mature ID let-7f-1-3p

miRNA Sequence

 CUAUACAAUCUAUUGCCUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-192 directly targets SLC16A14 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-215 directly targets SLC16A14 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

 AUGACCUAUGAAUUGACAGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-300 directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-300 miRNA Mature ID miR-300

miRNA Sequence

 UAUACAAGGGCAGACUCUCUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-340 directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-340 miRNA Mature ID miR-340-5p

miRNA Sequence

 UUAUAAAGCAAUGAGACUGAUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-381 directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-381 miRNA Mature ID miR-381-3p

miRNA Sequence

 UAUACAAGGGCAAGCUCUCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-4422 directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4422 miRNA Mature ID miR-4422

miRNA Sequence

 AAAAGCAUCAGGAAGUACCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-4666a directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4666a miRNA Mature ID miR-4666a-3p

miRNA Sequence

 CAUACAAUCUGACAUGUAUUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-548ad directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548ad miRNA Mature ID miR-548ad-3p

miRNA Sequence

 GAAAACGACAAUGACUUUUGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-5589 directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5589 miRNA Mature ID miR-5589-3p

miRNA Sequence

 UGCACAUGGCAACCUAGCUCCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-6835 directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6835 miRNA Mature ID miR-6835-3p

miRNA Sequence

 AAAAGCACUUUUCUGUCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-7849 directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7849 miRNA Mature ID miR-7849-3p

miRNA Sequence

 GACAAUUGUUGAUCUUGGGCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-98 directly targets SLC16A14 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-3p

miRNA Sequence

 CUAUACAACUUACUACUUUCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
3 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-wide Scan for Methylation Profiles in Breast Cancer
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
13 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.