Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0110 Transporter Info | ||||
Gene Name | SLC16A6 | ||||
Transporter Name | Monocarboxylate transporter 7 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
23 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-124 directly targets SLC16A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 2 |
miR-1277 directly targets SLC16A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1277 | miRNA Mature ID | miR-1277-5p | ||
miRNA Sequence |
AAAUAUAUAUAUAUAUGUACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 3 |
miR-190a directly targets SLC16A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-190a | miRNA Mature ID | miR-190a-3p | ||
miRNA Sequence |
CUAUAUAUCAAACAUAUUCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-192 directly targets SLC16A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-192 | miRNA Mature ID | miR-192-5p | ||
miRNA Sequence |
CUGACCUAUGAAUUGACAGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-215 directly targets SLC16A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-215 | miRNA Mature ID | miR-215-5p | ||
miRNA Sequence |
AUGACCUAUGAAUUGACAGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-3152 directly targets SLC16A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3152 | miRNA Mature ID | miR-3152-3p | ||
miRNA Sequence |
UGUGUUAGAAUAGGGGCAAUAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-335 directly targets SLC16A6 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-3675 directly targets SLC16A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3675 | miRNA Mature ID | miR-3675-3p | ||
miRNA Sequence |
CAUCUCUAAGGAACUCCCCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-3684 directly targets SLC16A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3684 | miRNA Mature ID | miR-3684 | ||
miRNA Sequence |
UUAGACCUAGUACACGUCCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-3688 directly targets SLC16A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3688 | miRNA Mature ID | miR-3688-3p | ||
miRNA Sequence |
UAUGGAAAGACUUUGCCACUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-4282 directly targets SLC16A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4282 | miRNA Mature ID | miR-4282 | ||
miRNA Sequence |
UAAAAUUUGCAUCCAGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 12 |
miR-4427 directly targets SLC16A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4427 | miRNA Mature ID | miR-4427 | ||
miRNA Sequence |
UCUGAAUAGAGUCUGAAGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-4495 directly targets SLC16A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4495 | miRNA Mature ID | miR-4495 | ||
miRNA Sequence |
AAUGUAAACAGGCUUUUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-4724 directly targets SLC16A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4724 | miRNA Mature ID | miR-4724-5p | ||
miRNA Sequence |
AACUGAACCAGGAGUGAGCUUCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-5011 directly targets SLC16A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5011 | miRNA Mature ID | miR-5011-5p | ||
miRNA Sequence |
UAUAUAUACAGCCAUGCACUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 16 |
miR-5197 directly targets SLC16A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5197 | miRNA Mature ID | miR-5197-3p | ||
miRNA Sequence |
AAGAAGAGACUGAGUCAUCGAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-5580 directly targets SLC16A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5580 | miRNA Mature ID | miR-5580-3p | ||
miRNA Sequence |
CACAUAUGAAGUGAGCCAGCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-6083 directly targets SLC16A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6083 | miRNA Mature ID | miR-6083 | ||
miRNA Sequence |
CUUAUAUCAGAGGCUGUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 19 |
miR-643 directly targets SLC16A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-643 | miRNA Mature ID | miR-643 | ||
miRNA Sequence |
ACUUGUAUGCUAGCUCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 20 |
miR-6502 directly targets SLC16A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6502 | miRNA Mature ID | miR-6502-3p | ||
miRNA Sequence |
UAGACCAUCUUUCUAGAGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 21 |
miR-6856 directly targets SLC16A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6856 | miRNA Mature ID | miR-6856-3p | ||
miRNA Sequence |
UACAGCCCUGUGAUCUUUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-8076 directly targets SLC16A6 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8076 | miRNA Mature ID | miR-8076 | ||
miRNA Sequence |
UAUAUGGACUUUUCUGAUACAAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 23 |
miR-891b directly targets SLC16A6 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-891b | miRNA Mature ID | miR-891b | ||
miRNA Sequence |
UGCAACUUACCUGAGUCAUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.