Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0114 Transporter Info
Gene Name	SLC17A1
Transporter Name	Sodium-dependent phosphate transport protein 1
Gene ID	6568
UniProt ID	Q14916

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg03835296)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.03E-08; Z-score: 1.69E+00
Methylation in Case	9.30E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg22101098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 5.69E-06; Z-score: -6.23E-01
Methylation in Case	8.72E-01 (Median)	Methylation in Control	9.09E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg24766398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 8.18E-06; Z-score: -1.13E+00
Methylation in Case	3.24E-01 (Median)	Methylation in Control	4.38E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg06885175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.98E-13; Z-score: -2.85E+00
Methylation in Case	8.19E-01 (Median)	Methylation in Control	9.03E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg24766398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.40E+00	Statistic Test	p-value: 7.32E-11; Z-score: -1.04E+01
Methylation in Case	2.41E-01 (Median)	Methylation in Control	5.77E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg03835296)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.73E+00	Statistic Test	p-value: 1.24E-10; Z-score: -2.91E+01
Methylation in Case	4.76E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg22101098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 1.25E-07; Z-score: -1.48E+01
Methylation in Case	5.78E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A1 in bladder cancer			[ 2 ]
Location	TSS200 (cg22988581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.39E+00	Statistic Test	p-value: 8.47E-06; Z-score: -5.22E+00
Methylation in Case	1.53E-01 (Median)	Methylation in Control	3.64E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A1 in bladder cancer			[ 2 ]
Location	3'UTR (cg06885175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -4.03E+00	Statistic Test	p-value: 3.19E-05; Z-score: -5.52E+00
Methylation in Case	8.50E-02 (Median)	Methylation in Control	3.42E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A1 in breast cancer			[ 3 ]
Location	5'UTR (cg22101098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 1.06E-05; Z-score: 1.77E+00
Methylation in Case	7.74E-01 (Median)	Methylation in Control	6.71E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A1 in breast cancer			[ 3 ]
Location	5'UTR (cg24766398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 2.37E-02; Z-score: 8.86E-01
Methylation in Case	4.63E-01 (Median)	Methylation in Control	4.03E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A1 in breast cancer			[ 3 ]
Location	TSS200 (cg22988581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 2.17E-03; Z-score: -9.72E-01
Methylation in Case	4.65E-01 (Median)	Methylation in Control	5.08E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A1 in breast cancer			[ 3 ]
Location	Body (cg19490609)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 7.45E-07; Z-score: 1.83E+00
Methylation in Case	4.59E-01 (Median)	Methylation in Control	3.56E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg24766398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 1.93E-07; Z-score: -1.82E+00
Methylation in Case	6.30E-01 (Median)	Methylation in Control	7.74E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg03835296)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.21E-06; Z-score: -2.15E+00
Methylation in Case	8.68E-01 (Median)	Methylation in Control	9.11E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A1 in colorectal cancer			[ 4 ]
Location	5'UTR (cg22101098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.22E-04; Z-score: -9.24E-01
Methylation in Case	8.78E-01 (Median)	Methylation in Control	9.06E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A1 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg26691898)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.41E-07; Z-score: -2.07E+00
Methylation in Case	8.86E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A1 in colorectal cancer			[ 4 ]
Location	3'UTR (cg06885175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.35E+00	Statistic Test	p-value: 2.38E-04; Z-score: -1.06E+00
Methylation in Case	2.42E-01 (Median)	Methylation in Control	3.27E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Significant hypermethylation of SLC17A1 in colorectal cancer than that in healthy individual
Studied Phenotype	Colorectal cancer [ICD-11:2B91]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.39E-08; Fold-change: 0.317341629; Z-score: 1.209543568
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
HIV infection	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A1 in HIV infection			[ 5 ]
Location	5'UTR (cg24766398)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.40E-03; Z-score: -9.90E-01
Methylation in Case	7.74E-01 (Median)	Methylation in Control	8.27E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A1 in HIV infection			[ 5 ]
Location	TSS200 (cg22988581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.25E-03; Z-score: -7.84E-01
Methylation in Case	7.51E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A1 in HIV infection			[ 5 ]
Location	3'UTR (cg06885175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.51E+00	Statistic Test	p-value: 1.24E-04; Z-score: 1.35E+00
Methylation in Case	2.52E-01 (Median)	Methylation in Control	1.67E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A1 in lung adenocarcinoma			[ 6 ]
Location	5'UTR (cg03835296)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.56E-02; Z-score: -1.30E+00
Methylation in Case	7.90E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A1 in lung adenocarcinoma			[ 6 ]
Location	TSS200 (cg22988581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 2.67E-02; Z-score: -1.63E+00
Methylation in Case	5.31E-01 (Median)	Methylation in Control	6.35E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	5'UTR (cg05043886)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 2.23E-09; Z-score: 1.71E+00
Methylation in Case	3.25E-01 (Median)	Methylation in Control	2.41E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg01151699)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 2.43E-14; Z-score: 1.59E+00
Methylation in Case	7.54E-02 (Median)	Methylation in Control	5.52E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg00999623)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 2.30E-04; Z-score: -8.97E-01
Methylation in Case	1.32E-01 (Median)	Methylation in Control	1.58E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A1 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg08424219)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 8.34E-03; Z-score: -4.52E-01
Methylation in Case	9.65E-02 (Median)	Methylation in Control	1.19E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A1 in papillary thyroid cancer			[ 8 ]
Location	5'UTR (cg22101098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 2.47E-03; Z-score: 6.92E-01
Methylation in Case	5.68E-01 (Median)	Methylation in Control	5.11E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A1 in papillary thyroid cancer			[ 8 ]
Location	3'UTR (cg06885175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 5.36E-04; Z-score: -1.19E+00
Methylation in Case	2.48E-01 (Median)	Methylation in Control	3.26E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A1 in hepatocellular carcinoma			[ 9 ]
Location	TSS1500 (cg26691898)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.37E-04; Z-score: -6.36E-01
Methylation in Case	7.88E-01 (Median)	Methylation in Control	8.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A1 in hepatocellular carcinoma			[ 9 ]
Location	TSS200 (cg07888856)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 6.70E+00	Statistic Test	p-value: 9.38E-14; Z-score: 1.31E+01
Methylation in Case	2.76E-01 (Median)	Methylation in Control	4.12E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A1 in hepatocellular carcinoma			[ 9 ]
Location	TSS200 (cg07808555)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.46E+00	Statistic Test	p-value: 5.08E-12; Z-score: 2.49E+00
Methylation in Case	1.85E-01 (Median)	Methylation in Control	7.54E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A1 in hepatocellular carcinoma			[ 9 ]
Location	Body (cg19490609)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 3.02E-02; Z-score: 8.78E-01
Methylation in Case	6.86E-01 (Median)	Methylation in Control	6.17E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A1 in hepatocellular carcinoma			[ 9 ]
Location	3'UTR (cg06885175)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 6.70E-05; Z-score: -7.98E-01
Methylation in Case	1.32E-01 (Median)	Methylation in Control	1.66E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate/moderate hypomethylation of SLC17A1 in liver cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000857727; Fold-change: -0.273796368; Z-score: -1.094861211
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 2.07E-11; Fold-change: -0.250044978; Z-score: -2.619104924
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Cerebellar liponeurocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC17A1 in cerebellar liponeurocytoma than that in healthy individual
Studied Phenotype	Cerebellar liponeurocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.010171838; Fold-change: 0.285047126; Z-score: 1.005873949
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC17A1 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.48E-12; Fold-change: 0.23651157; Z-score: 1.25327646
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Pituitary adenoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC17A1 in pituitary adenoma than that in healthy individual
Studied Phenotype	Pituitary adenoma [ICD-11:2F37]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.008230396; Fold-change: 0.293560842; Z-score: 5.497815096
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Chordoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC17A1 in chordoma than that in healthy individual
Studied Phenotype	Chordoma [ICD-11:5A61.0]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.019679349; Fold-change: -0.261206131; Z-score: -1.545974161
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Craniopharyngioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC17A1 in craniopharyngioma than that in healthy individual
Studied Phenotype	Craniopharyngioma [ICD-11:2F9A]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.005118004; Fold-change: -0.207162332; Z-score: -0.840836639
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Diffuse midline glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC17A1 in diffuse midline glioma than that in healthy individual
Studied Phenotype	Diffuse midline glioma [ICD-11:2A00.0Z]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.02E-09; Fold-change: -0.230624986; Z-score: -1.222796419
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Osteoarthritis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC17A1 in osteoarthritis than that in healthy individual
Studied Phenotype	Osteoarthritis [ICD-11:FA00]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 7.93E-11; Fold-change: -0.217409842; Z-score: -2.816531123
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Asthma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC17A1 in asthma than that in healthy individual
Studied Phenotype	Asthma [ICD-11:CA23]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.032594569; Fold-change: 0.45039513; Z-score: 1.464816356
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer metastasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC17A1 in prostate cancer metastasis than that in healthy individual
Studied Phenotype	Prostate cancer metastasis [ICD-11:2.00E+06]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.002507466; Fold-change: 0.395182376; Z-score: 9.51586899
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC17A1 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 9.05E-08; Fold-change: 0.663134939; Z-score: 4.549189725
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC17A1 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.22E-16; Fold-change: -0.494165435; Z-score: -2.300695929
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroepithelial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC17A1 in brain neuroepithelial tumour than that in healthy individual
Studied Phenotype	Brain neuroepithelial tumour [ICD-11:2A00.2Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.48E-11; Fold-change: -0.455198117; Z-score: -2.222922786
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lymphoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC17A1 in lymphoma than that in healthy individual
Studied Phenotype	Lymphoma [ICD-11:2B30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.09E-09; Fold-change: -0.409403034; Z-score: -2.172968245
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Medulloblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC17A1 in medulloblastoma than that in healthy individual
Studied Phenotype	Medulloblastoma [ICD-11:2A00.10]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.80E-69; Fold-change: -0.437787629; Z-score: -3.417360823
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Myxopapillary ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC17A1 in myxopapillary ependymoma than that in healthy individual
Studied Phenotype	Myxopapillary ependymoma [ICD-11:2A00.5]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.28E-18; Fold-change: -0.534586257; Z-score: -2.414801379
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Obesity	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC17A1 in obesity than that in healthy individual
Studied Phenotype	Obesity [ICD-11:5B81]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.11E-12; Fold-change: -0.424455702; Z-score: -2.919992715
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC17A1 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 8.63E-05; Fold-change: -0.359980178; Z-score: -1.510839483
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Uterine carcinosarcoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC17A1 in uterine carcinosarcoma than that in healthy individual
Studied Phenotype	Uterine carcinosarcoma [ICD-11:2B5F]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.002467143; Fold-change: -0.349579554; Z-score: -1.451803593
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Lung cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC17A1 in lung cancer than that in adjacent tissue
Studied Phenotype	Lung cancer [ICD-11:2C25]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 0.000529421; Fold-change: -0.312216056; Z-score: -2.562136049
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-335 directly targets SLC17A1			[ 10 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
6	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence