Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0115 Transporter Info
Gene Name SLC17A2
Transporter Name Sodium-dependent phosphate transport protein 3
Gene ID
10246
UniProt ID
O00624
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg09125430)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 6.08E+00 Statistic Test p-value: 4.38E-40; Z-score: 1.73E+01

Methylation in Case

 3.80E-01 (Median) Methylation in Control 6.24E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg23702688)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 6.19E-05; Z-score: -1.12E+00

Methylation in Case

 2.60E-01 (Median) Methylation in Control 3.10E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg19016972)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 1.30E-09; Z-score: -1.94E+00

Methylation in Case

 7.12E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg20955989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 4.53E-06; Z-score: 8.35E-01

Methylation in Case

 3.46E-01 (Median) Methylation in Control 2.84E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A2 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg23745839)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 4.30E-05; Z-score: 6.85E-01

Methylation in Case

 2.37E-01 (Median) Methylation in Control 1.99E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in bladder cancer [ 2 ]

Location

 TSS1500 (cg20765441)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 5.50E-06; Z-score: -3.95E+00

Methylation in Case

 4.55E-01 (Median) Methylation in Control 6.23E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in bladder cancer [ 2 ]

Location

 TSS200 (cg09546929)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.25E+00 Statistic Test p-value: 9.17E-14; Z-score: -1.88E+01

Methylation in Case

 3.76E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A2 in bladder cancer [ 2 ]

Location

 TSS200 (cg01382804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.53E+00 Statistic Test p-value: 2.84E-13; Z-score: -1.41E+01

Methylation in Case

 3.34E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A2 in bladder cancer [ 2 ]

Location

 TSS200 (cg20373747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.22E+00 Statistic Test p-value: 3.15E-12; Z-score: -1.07E+02

Methylation in Case

 3.83E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A2 in bladder cancer [ 2 ]

Location

 TSS200 (cg04867634)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.89E+00 Statistic Test p-value: 2.52E-11; Z-score: -3.52E+01

Methylation in Case

 4.77E-01 (Median) Methylation in Control 9.01E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A2 in bladder cancer [ 2 ]

Location

 Body (cg08278435)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 1.73E-03; Z-score: -4.60E+00

Methylation in Case

 5.88E-01 (Median) Methylation in Control 7.43E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC17A2 in bladder cancer [ 2 ]

Location

 3'UTR (cg27312087)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 2.22E-05; Z-score: 4.76E+00

Methylation in Case

 8.40E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in breast cancer [ 3 ]

Location

 TSS1500 (cg20765441)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 6.48E-08; Z-score: -1.84E+00

Methylation in Case

 5.51E-01 (Median) Methylation in Control 6.54E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in breast cancer [ 3 ]

Location

 TSS1500 (cg01936555)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.01E-03; Z-score: -6.21E-01

Methylation in Case

 9.08E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A2 in breast cancer [ 3 ]

Location

 TSS200 (cg09546929)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.94E-08; Z-score: -1.59E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A2 in breast cancer [ 3 ]

Location

 TSS200 (cg01382804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 8.97E-06; Z-score: -1.28E+00

Methylation in Case

 8.19E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A2 in breast cancer [ 3 ]

Location

 TSS200 (cg20373747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.31E-04; Z-score: -1.21E+00

Methylation in Case

 8.14E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A2 in breast cancer [ 3 ]

Location

 TSS200 (cg04867634)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 8.03E-04; Z-score: -5.27E-01

Methylation in Case

 9.05E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC17A2 in breast cancer [ 3 ]

Location

 Body (cg08278435)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 1.47E-13; Z-score: -3.27E+00

Methylation in Case

 6.99E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg20765441)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 3.30E-06; Z-score: -1.68E+00

Methylation in Case

 5.36E-01 (Median) Methylation in Control 6.69E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg24163360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.53E-02; Z-score: -5.02E-01

Methylation in Case

 8.02E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A2 in colorectal cancer [ 4 ]

Location

 TSS200 (cg20373747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.17E-04; Z-score: -6.82E-01

Methylation in Case

 9.40E-01 (Median) Methylation in Control 9.48E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A2 in colorectal cancer [ 4 ]

Location

 TSS200 (cg09546929)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 9.64E-04; Z-score: -9.53E-01

Methylation in Case

 8.96E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A2 in colorectal cancer [ 4 ]

Location

 Body (cg08278435)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 4.34E-10; Z-score: -3.10E+00

Methylation in Case

 7.95E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg24163360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 6.49E-04; Z-score: -8.29E-01

Methylation in Case

 3.64E-01 (Median) Methylation in Control 4.58E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg20765441)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 1.68E-03; Z-score: -9.59E-01

Methylation in Case

 2.44E-01 (Median) Methylation in Control 3.00E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg01936555)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.80E-02; Z-score: -5.25E-01

Methylation in Case

 6.35E-01 (Median) Methylation in Control 7.06E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg20373747)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 5.80E-09; Z-score: -1.29E+00

Methylation in Case

 4.58E-01 (Median) Methylation in Control 5.85E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg04867634)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 2.01E-08; Z-score: -1.44E+00

Methylation in Case

 4.60E-01 (Median) Methylation in Control 6.15E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg01382804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 3.61E-08; Z-score: -1.24E+00

Methylation in Case

 4.00E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 TSS200 (cg09546929)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 1.63E-07; Z-score: -1.17E+00

Methylation in Case

 4.31E-01 (Median) Methylation in Control 5.72E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg12913587)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 4.24E-15; Z-score: -5.29E+00

Methylation in Case

 5.84E-01 (Median) Methylation in Control 8.42E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg07834249)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 3.40E-12; Z-score: -7.62E+00

Methylation in Case

 6.29E-01 (Median) Methylation in Control 8.18E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC17A2 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg08278435)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 9.20E-04; Z-score: 5.67E-01

Methylation in Case

 8.37E-01 (Median) Methylation in Control 8.11E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in HIV infection [ 6 ]

Location

 TSS1500 (cg24163360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 8.72E-03; Z-score: -2.16E-01

Methylation in Case

 9.17E-01 (Median) Methylation in Control 9.24E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in HIV infection [ 6 ]

Location

 TSS200 (cg09546929)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.13E-02; Z-score: -8.88E-01

Methylation in Case

 9.13E-01 (Median) Methylation in Control 9.31E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A2 in HIV infection [ 6 ]

Location

 TSS200 (cg01382804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.57E-02; Z-score: -5.11E-01

Methylation in Case

 9.29E-01 (Median) Methylation in Control 9.40E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A2 in HIV infection [ 6 ]

Location

 Body (cg08278435)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 7.08E-06; Z-score: -2.43E+00

Methylation in Case

 8.10E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg20765441)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 8.32E-04; Z-score: -6.85E-01

Methylation in Case

 7.98E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg01936555)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 6.03E-03; Z-score: -5.14E-01

Methylation in Case

 9.41E-01 (Median) Methylation in Control 9.48E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A2 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg24163360)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.01E-02; Z-score: -7.42E-01

Methylation in Case

 9.05E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A2 in papillary thyroid cancer [ 7 ]

Location

 Body (cg08278435)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.04E-02; Z-score: -1.40E-01

Methylation in Case

 9.00E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A2 in papillary thyroid cancer [ 7 ]

Location

 3'UTR (cg27312087)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 3.22E-02; Z-score: -1.32E-01

Methylation in Case

 8.88E-01 (Median) Methylation in Control 8.91E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in prostate cancer [ 8 ]

Location

 TSS1500 (cg06689659)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 4.30E-02; Z-score: 1.51E+00

Methylation in Case

 9.42E-01 (Median) Methylation in Control 9.23E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in prostate cancer [ 8 ]

Location

 TSS200 (cg27645955)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 7.71E+00 Statistic Test p-value: 1.13E-02; Z-score: 2.67E+01

Methylation in Case

 3.53E-01 (Median) Methylation in Control 4.58E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in lung adenocarcinoma [ 9 ]

Location

 TSS200 (cg04867634)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.05E-02; Z-score: 1.61E+00

Methylation in Case

 9.02E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in lung adenocarcinoma [ 9 ]

Location

 Body (cg08278435)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.51E-02; Z-score: -1.42E+00

Methylation in Case

 7.46E-01 (Median) Methylation in Control 8.08E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in panic disorder [ 10 ]

Location

 TSS200 (cg09546929)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.91E-04; Z-score: 6.05E-01

Methylation in Case

 2.55E+00 (Median) Methylation in Control 2.42E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in panic disorder [ 10 ]

Location

 TSS200 (cg01382804)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.82E-02; Z-score: 5.18E-01

Methylation in Case

 2.33E+00 (Median) Methylation in Control 2.19E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 Body (cg08278435)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 5.67E-03; Z-score: -6.97E-01

Methylation in Case

 8.13E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A2 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 3'UTR (cg27312087)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.73E+00 Statistic Test p-value: 3.38E-09; Z-score: -1.77E+00

Methylation in Case

 2.23E-01 (Median) Methylation in Control 3.87E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A2 in depression [ 12 ]

Location

 Body (cg08278435)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.98E-02; Z-score: -3.27E-01

Methylation in Case

 7.95E-01 (Median) Methylation in Control 8.03E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-335 directly targets SLC17A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.