Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0117 Transporter Info
Gene Name SLC17A4
Transporter Name Probable small intestine urate exporter
Gene ID
10050
UniProt ID
Q9Y2C5
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg09750510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.94E-07; Z-score: -9.41E-01

Methylation in Case

 8.91E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg13261725)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 5.58E-07; Z-score: -1.03E+00

Methylation in Case

 7.44E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg27613749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.90E+00 Statistic Test p-value: 1.40E-05; Z-score: -1.09E+00

Methylation in Case

 1.49E-01 (Median) Methylation in Control 2.83E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A4 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg06996739)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.17E-03; Z-score: 6.61E-01

Methylation in Case

 8.40E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A4 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg08794539)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.88E+00 Statistic Test p-value: 7.96E-03; Z-score: -6.56E-01

Methylation in Case

 4.91E-02 (Median) Methylation in Control 1.41E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A4 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg22865713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 6.49E-10; Z-score: -1.63E+00

Methylation in Case

 4.61E-01 (Median) Methylation in Control 6.64E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 5'UTR (cg13261725)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 3.40E-04; Z-score: -4.14E+00

Methylation in Case

 7.55E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 5'UTR (cg27613749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 5.23E-04; Z-score: -5.94E+00

Methylation in Case

 8.06E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 5'UTR (cg09750510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 3.82E-03; Z-score: -1.82E+00

Methylation in Case

 6.55E-01 (Median) Methylation in Control 7.11E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 TSS1500 (cg04083466)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.77E+00 Statistic Test p-value: 2.96E-14; Z-score: -1.96E+01

Methylation in Case

 4.74E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 TSS1500 (cg15916061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.63E+00 Statistic Test p-value: 5.22E-09; Z-score: -6.51E+00

Methylation in Case

 4.31E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 TSS1500 (cg21627181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.04E-04; Z-score: -3.33E+00

Methylation in Case

 5.65E-01 (Median) Methylation in Control 7.08E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 Body (cg16156617)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.01E+00 Statistic Test p-value: 3.80E-09; Z-score: -8.13E+00

Methylation in Case

 2.93E-01 (Median) Methylation in Control 5.91E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 Body (cg27087243)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.64E+00 Statistic Test p-value: 1.13E-06; Z-score: -1.92E+01

Methylation in Case

 4.25E-01 (Median) Methylation in Control 6.95E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 Body (cg06996739)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 9.36E-04; Z-score: -4.90E+00

Methylation in Case

 8.49E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 Body (cg08794539)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.91E-03; Z-score: -1.83E+00

Methylation in Case

 9.02E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC17A4 in bladder cancer [ 2 ]

Location

 3'UTR (cg22865713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.96E+00 Statistic Test p-value: 6.65E-05; Z-score: -3.99E+00

Methylation in Case

 1.58E-01 (Median) Methylation in Control 3.09E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in breast cancer [ 3 ]

Location

 5'UTR (cg13261725)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 5.68E-08; Z-score: -1.74E+00

Methylation in Case

 7.90E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in breast cancer [ 3 ]

Location

 5'UTR (cg09750510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.12E-07; Z-score: -1.31E+00

Methylation in Case

 6.41E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in breast cancer [ 3 ]

Location

 5'UTR (cg27613749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.28E-06; Z-score: -1.30E+00

Methylation in Case

 8.59E-01 (Median) Methylation in Control 8.97E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A4 in breast cancer [ 3 ]

Location

 TSS1500 (cg04083466)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 6.29E-13; Z-score: -3.87E+00

Methylation in Case

 7.48E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A4 in breast cancer [ 3 ]

Location

 TSS1500 (cg15916061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 5.37E-08; Z-score: -2.44E+00

Methylation in Case

 6.14E-01 (Median) Methylation in Control 6.88E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A4 in breast cancer [ 3 ]

Location

 TSS1500 (cg21627181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 5.08E-06; Z-score: -1.21E+00

Methylation in Case

 7.49E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC17A4 in breast cancer [ 3 ]

Location

 Body (cg16156617)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.63E-04; Z-score: -1.36E+00

Methylation in Case

 5.65E-01 (Median) Methylation in Control 6.31E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC17A4 in breast cancer [ 3 ]

Location

 Body (cg27087243)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 2.70E-04; Z-score: -1.10E+00

Methylation in Case

 4.91E-01 (Median) Methylation in Control 5.94E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC17A4 in breast cancer [ 3 ]

Location

 3'UTR (cg22865713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 2.08E-03; Z-score: 1.18E+00

Methylation in Case

 4.58E-01 (Median) Methylation in Control 3.95E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in colorectal cancer [ 4 ]

Location

 5'UTR (cg09750510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.87E-04; Z-score: -9.76E-01

Methylation in Case

 8.39E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg21627181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.72E-02; Z-score: 9.11E-01

Methylation in Case

 7.33E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in colorectal cancer [ 4 ]

Location

 Body (cg27087243)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.65E-05; Z-score: -1.19E+00

Methylation in Case

 7.91E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A4 in colorectal cancer [ 4 ]

Location

 Body (cg16156617)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 5.55E-03; Z-score: -4.78E-01

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A4 in colorectal cancer [ 4 ]

Location

 3'UTR (cg22865713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 2.11E-02; Z-score: -8.02E-01

Methylation in Case

 6.73E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in hepatocellular carcinoma [ 5 ]

Location

 5'UTR (cg27613749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 5.85E-08; Z-score: -1.58E+00

Methylation in Case

 4.63E-01 (Median) Methylation in Control 6.06E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg21627181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 9.77E-09; Z-score: -1.32E+00

Methylation in Case

 4.87E-01 (Median) Methylation in Control 5.71E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg15916061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.55E-04; Z-score: -1.26E+00

Methylation in Case

 4.30E-01 (Median) Methylation in Control 4.92E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg04083466)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.65E-03; Z-score: -3.54E-01

Methylation in Case

 7.92E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A4 in hepatocellular carcinoma [ 5 ]

Location

 1stExon (cg02192965)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 6.97E-12; Z-score: -2.91E+00

Methylation in Case

 5.45E-01 (Median) Methylation in Control 7.26E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg24756227)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.42E+00 Statistic Test p-value: 2.36E-14; Z-score: -2.80E+00

Methylation in Case

 1.97E-01 (Median) Methylation in Control 2.79E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC17A4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg19204189)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 2.03E-12; Z-score: -6.56E+00

Methylation in Case

 6.65E-01 (Median) Methylation in Control 9.04E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC17A4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg00161124)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 2.89E-10; Z-score: -2.56E+00

Methylation in Case

 3.17E-01 (Median) Methylation in Control 4.86E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC17A4 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg27087243)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 2.33E-06; Z-score: -1.73E+00

Methylation in Case

 5.67E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in HIV infection [ 6 ]

Location

 5'UTR (cg13261725)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.88E-05; Z-score: -7.85E-01

Methylation in Case

 8.90E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in HIV infection [ 6 ]

Location

 5'UTR (cg09750510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 5.73E-05; Z-score: -1.35E+00

Methylation in Case

 7.24E-01 (Median) Methylation in Control 7.87E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in HIV infection [ 6 ]

Location

 TSS1500 (cg15916061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.87E-03; Z-score: -1.24E+00

Methylation in Case

 7.53E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A4 in HIV infection [ 6 ]

Location

 Body (cg16156617)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.18E-04; Z-score: -1.50E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A4 in HIV infection [ 6 ]

Location

 Body (cg27087243)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 8.02E-04; Z-score: -1.46E+00

Methylation in Case

 7.62E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A4 in HIV infection [ 6 ]

Location

 3'UTR (cg22865713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 7.60E-04; Z-score: -1.21E+00

Methylation in Case

 7.72E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in lung adenocarcinoma [ 7 ]

Location

 5'UTR (cg09750510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.30E-02; Z-score: -1.47E+00

Methylation in Case

 6.88E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in lung adenocarcinoma [ 7 ]

Location

 5'UTR (cg13261725)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.14E-02; Z-score: -2.37E+00

Methylation in Case

 8.32E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg04083466)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.74E-02; Z-score: -2.57E+00

Methylation in Case

 8.34E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A4 in lung adenocarcinoma [ 7 ]

Location

 3'UTR (cg22865713)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.39E-02; Z-score: 1.18E+00

Methylation in Case

 5.62E-01 (Median) Methylation in Control 4.97E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

 5'UTR (cg10806146)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.42E+00 Statistic Test p-value: 1.89E-06; Z-score: 1.24E+00

Methylation in Case

 5.12E-01 (Median) Methylation in Control 3.61E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS1500 (cg23995605)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.10E-04; Z-score: 7.00E-01

Methylation in Case

 9.09E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS200 (cg13323701)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.39E+00 Statistic Test p-value: 3.31E-26; Z-score: 7.44E+00

Methylation in Case

 1.90E-01 (Median) Methylation in Control 7.94E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS200 (cg00961640)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 3.01E-10; Z-score: -2.06E+00

Methylation in Case

 5.34E-01 (Median) Methylation in Control 7.13E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS200 (cg21590311)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 5.85E-06; Z-score: 1.15E+00

Methylation in Case

 7.71E-02 (Median) Methylation in Control 6.70E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg01040624)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 3.45E-11; Z-score: -2.29E+00

Methylation in Case

 7.61E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in papillary thyroid cancer [ 9 ]

Location

 5'UTR (cg13261725)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 9.96E-05; Z-score: -5.46E-01

Methylation in Case

 8.92E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in papillary thyroid cancer [ 9 ]

Location

 5'UTR (cg09750510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.72E-02; Z-score: -3.58E-01

Methylation in Case

 7.66E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in papillary thyroid cancer [ 9 ]

Location

 5'UTR (cg27613749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.30E-02; Z-score: -5.30E-01

Methylation in Case

 9.30E-01 (Median) Methylation in Control 9.39E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A4 in papillary thyroid cancer [ 9 ]

Location

 Body (cg08794539)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.99E-02; Z-score: -3.16E-01

Methylation in Case

 9.26E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A4 in papillary thyroid cancer [ 9 ]

Location

 Body (cg06996739)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.81E-02; Z-score: -5.09E-01

Methylation in Case

 8.87E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Celiac disease

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in celiac disease [ 10 ]

Location

 TSS1500 (cg04083466)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 3.53E-03; Z-score: 8.67E-01

Methylation in Case

 8.13E-01 (Median) Methylation in Control 6.45E-01 (Median)

Studied Phenotype

 Celiac disease [ ICD-11: DA95]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in depression [ 11 ]

Location

 TSS1500 (cg21627181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.30E-02; Z-score: -3.31E-01

Methylation in Case

 7.89E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in panic disorder [ 12 ]

Location

 Body (cg27087243)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 6.12E-03; Z-score: 3.74E-01

Methylation in Case

 2.02E+00 (Median) Methylation in Control 1.90E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in prostate cancer [ 13 ]

Location

 Body (cg16812174)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.55E+00 Statistic Test p-value: 1.32E-02; Z-score: -2.87E+00

Methylation in Case

 5.51E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A4 in prostate cancer [ 13 ]

Location

 Body (cg03216475)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 4.98E-02; Z-score: 1.75E+00

Methylation in Case

 8.27E-01 (Median) Methylation in Control 7.52E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A4 in prostate cancer [ 13 ]

Location

 Body (cg13939166)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 5.00E-02; Z-score: 1.44E+00

Methylation in Case

 8.75E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A4 in systemic lupus erythematosus [ 14 ]

Location

 Body (cg16156617)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.67E-02; Z-score: -1.27E-01

Methylation in Case

 8.04E-01 (Median) Methylation in Control 8.15E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-128 directly targets SLC17A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-128 miRNA Mature ID miR-128-3p

miRNA Sequence

 UCACAGUGAACCGGUCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
11 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.