Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0118 Transporter Info
Gene Name SLC17A5
Transporter Name Vesicular H(+)/Aspartate-glutamate cotransporter
Gene ID
26503
UniProt ID
Q9NRA2
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg26365742)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 1.27E-04; Z-score: -6.84E-01

Methylation in Case

 2.49E-01 (Median) Methylation in Control 3.13E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A5 in colon adenocarcinoma [ 1 ]

Location

 TSS200 (cg09837037)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 3.23E-04; Z-score: -1.55E+00

Methylation in Case

 5.93E-01 (Median) Methylation in Control 6.59E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A5 in colon adenocarcinoma [ 1 ]

Location

 1stExon (cg25437385)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.43E+00 Statistic Test p-value: 2.56E-07; Z-score: 4.08E+00

Methylation in Case

 4.67E-01 (Median) Methylation in Control 1.92E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A5 in colon adenocarcinoma [ 1 ]

Location

 Body (cg27357229)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.57E+00 Statistic Test p-value: 8.77E-08; Z-score: -3.70E+00

Methylation in Case

 3.97E-01 (Median) Methylation in Control 6.22E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A5 in colon adenocarcinoma [ 1 ]

Location

 Body (cg03047508)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 7.22E-06; Z-score: -5.32E+00

Methylation in Case

 6.58E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A5 in colon adenocarcinoma [ 1 ]

Location

 Body (cg14994247)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 8.17E-04; Z-score: -2.05E+00

Methylation in Case

 3.73E-01 (Median) Methylation in Control 4.49E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Bladder cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg13599248)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -4.33E+00 Statistic Test p-value: 1.80E-12; Z-score: -1.26E+01

Methylation in Case

 1.11E-01 (Median) Methylation in Control 4.79E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg11742202)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -4.73E+00 Statistic Test p-value: 2.94E-12; Z-score: -1.15E+01

Methylation in Case

 8.69E-02 (Median) Methylation in Control 4.11E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A5 in bladder cancer [ 2 ]

Location

 TSS1500 (cg00648153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 3.24E-02; Z-score: -1.30E+00

Methylation in Case

 5.98E-02 (Median) Methylation in Control 6.83E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A5 in bladder cancer [ 2 ]

Location

 1stExon (cg03528784)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.25E-02; Z-score: -1.25E+00

Methylation in Case

 6.27E-02 (Median) Methylation in Control 7.94E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A5 in bladder cancer [ 2 ]

Location

 3'UTR (cg09257923)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.44E-03; Z-score: -3.68E+00

Methylation in Case

 8.10E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg13599248)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.77E+00 Statistic Test p-value: 2.28E-09; Z-score: -3.03E+00

Methylation in Case

 2.53E-01 (Median) Methylation in Control 4.47E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A5 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg11742202)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.16E+00 Statistic Test p-value: 2.47E-08; Z-score: -3.16E+00

Methylation in Case

 1.75E-01 (Median) Methylation in Control 3.78E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A5 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg22208108)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.03E-05; Z-score: 1.41E+00

Methylation in Case

 2.77E-02 (Median) Methylation in Control 2.37E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A5 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg04332235)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 5.14E-03; Z-score: 2.81E-01

Methylation in Case

 3.53E-02 (Median) Methylation in Control 3.39E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC17A5 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg01454004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 5.67E-04; Z-score: 8.75E-01

Methylation in Case

 2.14E-02 (Median) Methylation in Control 1.73E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC17A5 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg05360422)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.82E-03; Z-score: 6.89E-01

Methylation in Case

 2.10E-02 (Median) Methylation in Control 1.94E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg11742202)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 4.70E-02; Z-score: -4.86E-01

Methylation in Case

 2.73E-01 (Median) Methylation in Control 3.15E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A5 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg00648153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.76E-02; Z-score: -4.60E-01

Methylation in Case

 1.18E-01 (Median) Methylation in Control 1.25E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A5 in colorectal cancer [ 4 ]

Location

 TSS200 (cg07554703)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 1.93E-05; Z-score: 1.23E+00

Methylation in Case

 2.76E-02 (Median) Methylation in Control 2.29E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A5 in colorectal cancer [ 4 ]

Location

 TSS200 (cg04332235)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 2.52E-04; Z-score: 6.36E-01

Methylation in Case

 3.81E-02 (Median) Methylation in Control 3.38E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg11742202)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 1.54E-05; Z-score: -9.90E-01

Methylation in Case

 1.04E-01 (Median) Methylation in Control 1.49E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A5 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg13599248)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 1.85E-05; Z-score: -8.96E-01

Methylation in Case

 1.33E-01 (Median) Methylation in Control 1.75E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A5 in hepatocellular carcinoma [ 5 ]

Location

 Body (cg12619347)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.35E+00 Statistic Test p-value: 7.84E-13; Z-score: -2.32E+00

Methylation in Case

 4.33E-01 (Median) Methylation in Control 5.83E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A5 in hepatocellular carcinoma [ 5 ]

Location

 3'UTR (cg09257923)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 7.96E-05; Z-score: -4.27E-01

Methylation in Case

 8.08E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in HIV infection [ 6 ]

Location

 TSS1500 (cg00648153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.51E+00 Statistic Test p-value: 2.38E-03; Z-score: 1.42E+00

Methylation in Case

 6.18E-02 (Median) Methylation in Control 4.09E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A5 in HIV infection [ 6 ]

Location

 TSS200 (cg04332235)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.33E-02; Z-score: 3.13E-01

Methylation in Case

 5.20E-02 (Median) Methylation in Control 4.67E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in pancretic ductal adenocarcinoma [ 7 ]

Location

 TSS1500 (cg13925623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.96E-03; Z-score: 8.28E-02

Methylation in Case

 1.68E-01 (Median) Methylation in Control 1.65E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg00648153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.47E-04; Z-score: -3.49E-01

Methylation in Case

 3.22E-02 (Median) Methylation in Control 3.56E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in systemic lupus erythematosus [ 9 ]

Location

 TSS1500 (cg00648153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 7.52E-03; Z-score: -1.74E-01

Methylation in Case

 8.09E-02 (Median) Methylation in Control 8.40E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in lung adenocarcinoma [ 10 ]

Location

 TSS200 (cg22208108)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 2.08E-02; Z-score: 9.41E-01

Methylation in Case

 4.70E-02 (Median) Methylation in Control 3.91E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 1stExon (cg03528784)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 1.19E-25; Z-score: -6.13E+00

Methylation in Case

 6.25E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC17A5 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 Body (cg01454004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 6.95E-05; Z-score: 9.11E-01

Methylation in Case

 8.65E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC17A5 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 Body (cg05360422)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.40E-03; Z-score: 8.11E-01

Methylation in Case

 8.36E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC17A5 in atypical teratoid rhabdoid tumor [ 11 ]

Location

 3'UTR (cg09257923)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.27E-12; Z-score: -2.36E+00

Methylation in Case

 8.33E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in breast cancer [ 12 ]

Location

 Body (cg01454004)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 9.57E-03; Z-score: 5.07E-01

Methylation in Case

 6.21E-02 (Median) Methylation in Control 5.57E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC17A5 in depression [ 13 ]

Location

 3'UTR (cg09257923)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.82E-02; Z-score: 5.58E-01

Methylation in Case

 8.63E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          16 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-124 directly targets SLC17A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-142 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-142 miRNA Mature ID miR-142-3p

miRNA Sequence

 UGUAGUGUUUCCUACUUUAUGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-1827 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1827 miRNA Mature ID miR-1827

miRNA Sequence

 UGAGGCAGUAGAUUGAAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-21 directly targets SLC17A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-21 miRNA Mature ID miR-21-5p

miRNA Sequence

 UAGCUUAUCAGACUGAUGUUGA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 miR-26b directly targets SLC17A5 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 6

 miR-323a directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-323a miRNA Mature ID miR-323a-3p

miRNA Sequence

 CACAUUACACGGUCGACCUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-335 directly targets SLC17A5 [ 18 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-4255 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4255 miRNA Mature ID miR-4255

miRNA Sequence

 CAGUGUUCAGAGAUGGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-4328 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4328 miRNA Mature ID miR-4328

miRNA Sequence

 CCAGUUUUCCCAGGAUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-633 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-633 miRNA Mature ID miR-633

miRNA Sequence

 CUAAUAGUAUCUACCACAAUAAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-6504 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6504 miRNA Mature ID miR-6504-3p

miRNA Sequence

 CAUUACAGCACAGCCAUUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-6808 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6808 miRNA Mature ID miR-6808-5p

miRNA Sequence

 CAGGCAGGGAGGUGGGACCAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-6866 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6866 miRNA Mature ID miR-6866-5p

miRNA Sequence

 UUAGAGGCUGGAAUAGAGAUUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-6893 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6893 miRNA Mature ID miR-6893-5p

miRNA Sequence

 CAGGCAGGUGUAGGGUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-940 directly targets SLC17A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-940 miRNA Mature ID miR-940

miRNA Sequence

 AAGGCAGGGCCCCCGCUCCCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-98 directly targets SLC17A5 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 DNA Methylation Dynamics in Urological Tumors.
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
12 Genome-wide Scan for Methylation Profiles in Breast Cancer
13 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
14 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
15 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
16 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.
17 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
18 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.