Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0119 Transporter Info
Gene Name	SLC17A6
Transporter Name	Vesicular glutamate transporter 2
Gene ID	57084
UniProt ID	Q9P2U8

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg13048512)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.02E+00	Statistic Test	p-value: 9.32E-09; Z-score: 3.51E+00
Methylation in Case	4.26E-01 (Median)	Methylation in Control	1.41E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in colon adenocarcinoma			[ 1 ]
Location	TSS1500 (cg06998507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 1.80E-04; Z-score: -1.36E+00
Methylation in Case	2.28E-01 (Median)	Methylation in Control	2.91E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg00339695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 7.01E-04; Z-score: -4.43E-01
Methylation in Case	4.73E-01 (Median)	Methylation in Control	5.16E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in colon adenocarcinoma			[ 1 ]
Location	Body (cg15371566)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 4.63E-07; Z-score: -5.21E+00
Methylation in Case	4.78E-01 (Median)	Methylation in Control	7.19E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in colon adenocarcinoma			[ 1 ]
Location	Body (cg21216944)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 7.77E-06; Z-score: -1.45E+00
Methylation in Case	8.27E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in colon adenocarcinoma			[ 1 ]
Location	Body (cg13944105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 4.20E-03; Z-score: -1.46E+00
Methylation in Case	5.62E-01 (Median)	Methylation in Control	6.80E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg02164452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.97E-03; Z-score: -3.89E-01
Methylation in Case	1.07E-01 (Median)	Methylation in Control	1.16E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg27613749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 9.57E-03; Z-score: 6.15E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.54E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	5'UTR (cg23909029)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 3.61E-02; Z-score: -2.97E-01
Methylation in Case	9.90E-02 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg12609243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 3.32E-11; Z-score: 6.63E-01
Methylation in Case	1.43E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg15445554)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 6.19E-12; Z-score: 1.32E+00
Methylation in Case	4.49E-01 (Median)	Methylation in Control	3.87E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS200 (cg07195660)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.01E-02; Z-score: 4.63E-01
Methylation in Case	4.49E-02 (Median)	Methylation in Control	4.12E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	1stExon (cg09892203)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.58E-05; Z-score: 1.63E-02
Methylation in Case	3.08E-02 (Median)	Methylation in Control	3.07E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg21516614)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.61E-07; Z-score: -8.07E-01
Methylation in Case	9.13E-01 (Median)	Methylation in Control	9.27E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg14495732)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 5.51E-05; Z-score: 1.08E+00
Methylation in Case	6.88E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg08758185)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 4.16E-04; Z-score: -5.56E-02
Methylation in Case	8.82E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg05636015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.51E-02; Z-score: 8.00E-01
Methylation in Case	8.48E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	3'UTR (cg18515046)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.11E-08; Z-score: 1.86E+00
Methylation in Case	5.84E-01 (Median)	Methylation in Control	4.90E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	3'UTR (cg16392193)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.31E-07; Z-score: -1.22E+00
Methylation in Case	3.99E-01 (Median)	Methylation in Control	4.38E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC17A6 in pancretic ductal adenocarcinoma			[ 2 ]
Location	3'UTR (cg19728345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 6.93E-07; Z-score: -1.46E+00
Methylation in Case	3.60E-01 (Median)	Methylation in Control	4.73E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	TSS1500 (cg25329013)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 2.97E-03; Z-score: -2.30E+00
Methylation in Case	1.00E-01 (Median)	Methylation in Control	1.27E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	TSS1500 (cg04270835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.41E-02; Z-score: 1.06E+00
Methylation in Case	1.26E-01 (Median)	Methylation in Control	1.19E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	TSS1500 (cg12778476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 4.45E-02; Z-score: -9.55E-01
Methylation in Case	3.36E-02 (Median)	Methylation in Control	4.68E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg20998200)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.60E+00	Statistic Test	p-value: 1.18E-16; Z-score: -2.04E+01
Methylation in Case	2.51E-01 (Median)	Methylation in Control	6.53E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg24454829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.42E+00	Statistic Test	p-value: 2.36E-11; Z-score: 1.10E+01
Methylation in Case	4.37E-01 (Median)	Methylation in Control	1.80E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg17298751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.42E+00	Statistic Test	p-value: 8.13E-10; Z-score: 9.63E+00
Methylation in Case	7.30E-01 (Median)	Methylation in Control	3.02E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg04583232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.30E+00	Statistic Test	p-value: 1.19E-09; Z-score: 8.96E+00
Methylation in Case	4.08E-01 (Median)	Methylation in Control	1.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg21518089)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.54E+00	Statistic Test	p-value: 1.49E-09; Z-score: 1.06E+01
Methylation in Case	4.40E-01 (Median)	Methylation in Control	1.73E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 5.84E+00	Statistic Test	p-value: 8.30E-08; Z-score: 3.58E+01
Methylation in Case	3.83E-01 (Median)	Methylation in Control	6.56E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg24151995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.28E+00	Statistic Test	p-value: 5.43E-06; Z-score: 7.61E+00
Methylation in Case	2.62E-01 (Median)	Methylation in Control	1.15E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg09150064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.79E+00	Statistic Test	p-value: 8.64E-06; Z-score: 9.08E+00
Methylation in Case	2.99E-01 (Median)	Methylation in Control	1.07E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg20809470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 6.38E-04; Z-score: 2.48E+00
Methylation in Case	1.65E-01 (Median)	Methylation in Control	1.23E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg16079774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.86E+00	Statistic Test	p-value: 9.55E-04; Z-score: 4.31E+00
Methylation in Case	8.63E-02 (Median)	Methylation in Control	4.65E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC17A6 in bladder cancer			[ 3 ]
Location	Body (cg22371972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 1.31E-02; Z-score: 2.18E+00
Methylation in Case	7.38E-02 (Median)	Methylation in Control	4.78E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	18 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	TSS1500 (cg04270835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.46E+00	Statistic Test	p-value: 8.46E-09; Z-score: 2.10E+00
Methylation in Case	1.49E-01 (Median)	Methylation in Control	1.02E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	TSS1500 (cg06517489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 2.58E-02; Z-score: 8.79E-02
Methylation in Case	7.35E-02 (Median)	Methylation in Control	7.23E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	TSS1500 (cg12778476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.66E-02; Z-score: 5.87E-02
Methylation in Case	3.40E-02 (Median)	Methylation in Control	3.31E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	TSS200 (cg23834895)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 1.69E-05; Z-score: 1.77E+00
Methylation in Case	4.10E-01 (Median)	Methylation in Control	3.21E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	TSS200 (cg09530407)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.13E-03; Z-score: 3.23E-01
Methylation in Case	8.14E-02 (Median)	Methylation in Control	7.51E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	TSS200 (cg16644457)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 9.64E-03; Z-score: 2.95E-01
Methylation in Case	1.00E-01 (Median)	Methylation in Control	9.38E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg24454829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.60E+00	Statistic Test	p-value: 1.33E-14; Z-score: 3.30E+00
Methylation in Case	3.88E-01 (Median)	Methylation in Control	2.43E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg04583232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 4.62E-14; Z-score: 2.04E+00
Methylation in Case	3.35E-01 (Median)	Methylation in Control	2.53E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg17298751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 6.07E-13; Z-score: 2.29E+00
Methylation in Case	6.31E-01 (Median)	Methylation in Control	4.76E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.04E+00	Statistic Test	p-value: 1.47E-11; Z-score: 2.87E+00
Methylation in Case	2.68E-01 (Median)	Methylation in Control	1.31E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg09150064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.61E+00	Statistic Test	p-value: 1.15E-08; Z-score: 2.50E+00
Methylation in Case	2.73E-01 (Median)	Methylation in Control	1.70E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg16079774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 2.42E-06; Z-score: 1.13E+00
Methylation in Case	8.17E-02 (Median)	Methylation in Control	5.99E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg22371972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.48E+00	Statistic Test	p-value: 3.28E-06; Z-score: 1.47E+00
Methylation in Case	7.26E-02 (Median)	Methylation in Control	4.92E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg24151995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 4.44E-05; Z-score: 1.01E+00
Methylation in Case	2.20E-01 (Median)	Methylation in Control	1.67E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg20998200)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 9.51E-05; Z-score: -1.76E+00
Methylation in Case	3.80E-01 (Median)	Methylation in Control	5.01E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg20809470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 5.00E-04; Z-score: 1.03E+00
Methylation in Case	1.36E-01 (Median)	Methylation in Control	1.14E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	Body (cg21518089)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 9.51E-04; Z-score: 8.19E-01
Methylation in Case	3.39E-01 (Median)	Methylation in Control	2.91E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC17A6 in breast cancer			[ 4 ]
Location	3'UTR (cg25335435)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.75E-05; Z-score: -5.65E-01
Methylation in Case	8.81E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Colorectal cancer	19 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg12778476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.09E-04; Z-score: -3.31E-02
Methylation in Case	6.33E-02 (Median)	Methylation in Control	6.42E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg06517489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.13E-04; Z-score: 6.71E-02
Methylation in Case	1.77E-01 (Median)	Methylation in Control	1.74E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg04270835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.39E-03; Z-score: 1.19E+00
Methylation in Case	5.55E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg25329013)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.94E-03; Z-score: -1.68E-01
Methylation in Case	2.49E-01 (Median)	Methylation in Control	2.56E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	TSS200 (cg09530407)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.14E+00	Statistic Test	p-value: 1.66E-12; Z-score: 4.28E+00
Methylation in Case	5.21E-01 (Median)	Methylation in Control	2.44E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	TSS200 (cg16644457)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.56E+00	Statistic Test	p-value: 2.67E-08; Z-score: 2.36E+00
Methylation in Case	5.07E-01 (Median)	Methylation in Control	3.24E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	TSS200 (cg23834895)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 1.50E-07; Z-score: 2.29E+00
Methylation in Case	6.98E-01 (Median)	Methylation in Control	5.54E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg20998200)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 1.21E-13; Z-score: -3.98E+00
Methylation in Case	5.26E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.34E+00	Statistic Test	p-value: 1.77E-10; Z-score: 3.62E+00
Methylation in Case	4.43E-01 (Median)	Methylation in Control	1.89E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg22371972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.18E+00	Statistic Test	p-value: 7.13E-09; Z-score: 3.16E+00
Methylation in Case	1.62E-01 (Median)	Methylation in Control	7.40E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg20809470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 3.75E-08; Z-score: 2.20E+00
Methylation in Case	4.03E-01 (Median)	Methylation in Control	3.01E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg09150064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 2.59E-05; Z-score: 2.45E+00
Methylation in Case	5.75E-01 (Median)	Methylation in Control	4.03E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg16079774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 2.86E-05; Z-score: 1.16E+00
Methylation in Case	3.63E-01 (Median)	Methylation in Control	2.63E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg04583232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 6.31E-05; Z-score: 1.39E+00
Methylation in Case	6.79E-01 (Median)	Methylation in Control	5.39E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg24151995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 4.67E-04; Z-score: 9.05E-01
Methylation in Case	5.24E-01 (Median)	Methylation in Control	4.26E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg24454829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.38E-02; Z-score: 3.74E-01
Methylation in Case	5.69E-01 (Median)	Methylation in Control	5.29E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	Body (cg17298751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.01E-02; Z-score: 6.44E-01
Methylation in Case	8.73E-01 (Median)	Methylation in Control	8.08E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC17A6 in colorectal cancer			[ 5 ]
Location	3'UTR (cg25335435)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 7.92E-03; Z-score: -8.25E-01
Methylation in Case	9.34E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	19 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg06594281)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.57E+00	Statistic Test	p-value: 2.72E-13; Z-score: 1.88E+00
Methylation in Case	5.76E-01 (Median)	Methylation in Control	3.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg02481956)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 2.30E-12; Z-score: -2.20E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	7.29E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg23099740)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 1.53E-09; Z-score: -2.30E+00
Methylation in Case	6.87E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg12778476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 2.64E-03; Z-score: -4.60E-01
Methylation in Case	5.48E-02 (Median)	Methylation in Control	6.60E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg14726581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.70E+00	Statistic Test	p-value: 1.45E-17; Z-score: -3.91E+00
Methylation in Case	4.05E-01 (Median)	Methylation in Control	6.88E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg15586392)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.88E+00	Statistic Test	p-value: 6.71E-13; Z-score: -1.73E+00
Methylation in Case	2.14E-01 (Median)	Methylation in Control	4.01E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg09530407)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 3.49E-05; Z-score: 8.48E-01
Methylation in Case	9.77E-02 (Median)	Methylation in Control	8.79E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	TSS200 (cg16644457)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 8.47E-05; Z-score: 8.40E-01
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	1stExon (cg02748539)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.48E+00	Statistic Test	p-value: 1.15E-09; Z-score: 3.78E+00
Methylation in Case	3.46E-01 (Median)	Methylation in Control	2.34E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg18645002)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 2.43E-16; Z-score: -5.79E+00
Methylation in Case	5.40E-01 (Median)	Methylation in Control	7.84E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg25703338)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 8.33E-16; Z-score: -8.59E+00
Methylation in Case	5.74E-01 (Median)	Methylation in Control	8.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg04583232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 1.44E-04; Z-score: 1.59E+00
Methylation in Case	2.64E-01 (Median)	Methylation in Control	2.17E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg22371972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 1.67E-04; Z-score: 2.60E-01
Methylation in Case	7.86E-02 (Median)	Methylation in Control	7.18E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg24454829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.32E-03; Z-score: 7.83E-01
Methylation in Case	2.33E-01 (Median)	Methylation in Control	2.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 15	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.51E-03; Z-score: -2.38E-02
Methylation in Case	9.94E-02 (Median)	Methylation in Control	1.00E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 16	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg21518089)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 3.76E-03; Z-score: 1.18E+00
Methylation in Case	2.71E-01 (Median)	Methylation in Control	2.29E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg17298751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 5.30E-03; Z-score: 1.34E+00
Methylation in Case	5.22E-01 (Median)	Methylation in Control	4.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 18	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg09150064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 6.06E-03; Z-score: -1.36E-01
Methylation in Case	1.46E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 19	Methylation of SLC17A6 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg24151995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 9.83E-03; Z-score: -1.61E+00
Methylation in Case	1.18E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	14 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	TSS1500 (cg12778476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.63E+00	Statistic Test	p-value: 1.14E-04; Z-score: 1.35E+00
Methylation in Case	3.84E-02 (Median)	Methylation in Control	2.35E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	TSS1500 (cg04270835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 5.30E-04; Z-score: 9.53E-01
Methylation in Case	1.64E-01 (Median)	Methylation in Control	1.34E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	TSS1500 (cg25329013)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 8.77E-03; Z-score: 4.83E-01
Methylation in Case	1.13E-01 (Median)	Methylation in Control	1.03E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	TSS1500 (cg06517489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 1.51E-02; Z-score: 5.48E-01
Methylation in Case	7.62E-02 (Median)	Methylation in Control	6.95E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg24454829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 9.83E-06; Z-score: 1.44E+00
Methylation in Case	2.46E-01 (Median)	Methylation in Control	1.91E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg17298751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.55E-05; Z-score: 1.27E+00
Methylation in Case	5.05E-01 (Median)	Methylation in Control	4.19E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg22371972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 1.60E-05; Z-score: 1.84E+00
Methylation in Case	8.52E-02 (Median)	Methylation in Control	5.55E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg04583232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.92E-05; Z-score: 1.49E+00
Methylation in Case	2.66E-01 (Median)	Methylation in Control	2.15E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.66E+00	Statistic Test	p-value: 2.51E-05; Z-score: 2.01E+00
Methylation in Case	1.20E-01 (Median)	Methylation in Control	7.19E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg20998200)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 3.16E-04; Z-score: -1.20E+00
Methylation in Case	6.91E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg21518089)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 4.96E-04; Z-score: 7.62E-01
Methylation in Case	2.54E-01 (Median)	Methylation in Control	2.32E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg16079774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 1.38E-02; Z-score: 9.76E-01
Methylation in Case	7.90E-02 (Median)	Methylation in Control	5.98E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg24151995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.59E-02; Z-score: 5.94E-01
Methylation in Case	1.90E-01 (Median)	Methylation in Control	1.71E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	Methylation of SLC17A6 in HIV infection			[ 7 ]
Location	Body (cg20809470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 4.53E-02; Z-score: 3.67E-01
Methylation in Case	1.86E-01 (Median)	Methylation in Control	1.76E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	TSS1500 (cg04270835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 4.84E-02; Z-score: 1.51E+00
Methylation in Case	2.10E-01 (Median)	Methylation in Control	1.48E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	TSS200 (cg09530407)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 1.86E-02; Z-score: 4.02E+00
Methylation in Case	1.50E-01 (Median)	Methylation in Control	1.05E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	Body (cg04583232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.51E+00	Statistic Test	p-value: 3.70E-04; Z-score: 2.27E+00
Methylation in Case	3.59E-01 (Median)	Methylation in Control	2.38E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	Body (cg24454829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.59E+00	Statistic Test	p-value: 8.51E-04; Z-score: 2.23E+00
Methylation in Case	3.73E-01 (Median)	Methylation in Control	2.35E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	Body (cg17298751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 5.12E-03; Z-score: 2.23E+00
Methylation in Case	6.22E-01 (Median)	Methylation in Control	4.94E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	Body (cg20998200)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 7.09E-03; Z-score: -1.70E+00
Methylation in Case	5.56E-01 (Median)	Methylation in Control	6.42E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	Body (cg21518089)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 8.37E-03; Z-score: 1.60E+00
Methylation in Case	3.27E-01 (Median)	Methylation in Control	2.41E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	Body (cg22371972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.43E+00	Statistic Test	p-value: 2.06E-02; Z-score: 3.76E+00
Methylation in Case	1.06E-01 (Median)	Methylation in Control	7.45E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.31E+00	Statistic Test	p-value: 2.44E-02; Z-score: 1.38E+00
Methylation in Case	2.46E-01 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC17A6 in lung adenocarcinoma			[ 8 ]
Location	Body (cg16079774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 4.97E-02; Z-score: 1.43E+00
Methylation in Case	1.26E-01 (Median)	Methylation in Control	8.97E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in panic disorder			[ 9 ]
Location	TSS1500 (cg12778476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.47E-01	Statistic Test	p-value: 5.54E-07; Z-score: 8.82E-01
Methylation in Case	-4.50E+00 (Median)	Methylation in Control	-4.75E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in panic disorder			[ 9 ]
Location	TSS1500 (cg06517489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.15E-01	Statistic Test	p-value: 1.07E-06; Z-score: 8.07E-01
Methylation in Case	-3.60E+00 (Median)	Methylation in Control	-3.93E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in panic disorder			[ 9 ]
Location	TSS1500 (cg04270835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.19E-01	Statistic Test	p-value: 6.24E-03; Z-score: 4.57E-01
Methylation in Case	-2.49E+00 (Median)	Methylation in Control	-2.71E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in panic disorder			[ 9 ]
Location	TSS1500 (cg25329013)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.45E-01	Statistic Test	p-value: 7.01E-03; Z-score: 5.73E-01
Methylation in Case	-3.76E+00 (Median)	Methylation in Control	-3.98E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in panic disorder			[ 9 ]
Location	TSS200 (cg09530407)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.51E-01	Statistic Test	p-value: 7.78E-03; Z-score: 4.26E-01
Methylation in Case	-4.08E+00 (Median)	Methylation in Control	-4.28E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in panic disorder			[ 9 ]
Location	TSS200 (cg23834895)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 8.55E-01	Statistic Test	p-value: 4.26E-02; Z-score: 2.75E-01
Methylation in Case	-1.26E+00 (Median)	Methylation in Control	-1.48E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in panic disorder			[ 9 ]
Location	Body (cg20998200)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.18E+00	Statistic Test	p-value: 4.03E-02; Z-score: -4.21E-01
Methylation in Case	-3.13E-02 (Median)	Methylation in Control	9.96E-02 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC17A6 in panic disorder			[ 9 ]
Location	3'UTR (cg25335435)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 5.33E-01	Statistic Test	p-value: 3.10E-04; Z-score: -7.29E-01
Methylation in Case	-2.20E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	TSS1500 (cg12778476)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.04E-02; Z-score: 2.30E-01
Methylation in Case	7.66E-02 (Median)	Methylation in Control	7.35E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	TSS1500 (cg04270835)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.56E-02; Z-score: 1.35E-01
Methylation in Case	1.01E-01 (Median)	Methylation in Control	9.81E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	Body (cg20998200)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 3.40E-09; Z-score: -2.17E+00
Methylation in Case	5.99E-01 (Median)	Methylation in Control	7.15E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	Body (cg04583232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 1.38E-05; Z-score: 1.11E+00
Methylation in Case	1.48E-01 (Median)	Methylation in Control	1.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 3.23E-05; Z-score: 8.61E-01
Methylation in Case	1.18E-01 (Median)	Methylation in Control	1.03E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	Body (cg16079774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 3.82E-04; Z-score: 5.85E-01
Methylation in Case	5.73E-02 (Median)	Methylation in Control	5.12E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	Body (cg22371972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 6.99E-04; Z-score: 7.63E-01
Methylation in Case	8.87E-02 (Median)	Methylation in Control	7.74E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	Body (cg17298751)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 1.53E-03; Z-score: 5.17E-01
Methylation in Case	3.18E-01 (Median)	Methylation in Control	2.79E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	Body (cg24151995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.40E-02; Z-score: -2.35E-01
Methylation in Case	8.77E-02 (Median)	Methylation in Control	9.30E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	Body (cg24454829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 2.74E-02; Z-score: 3.63E-01
Methylation in Case	1.38E-01 (Median)	Methylation in Control	1.24E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC17A6 in papillary thyroid cancer			[ 10 ]
Location	3'UTR (cg25335435)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.02E-02; Z-score: -1.99E-01
Methylation in Case	9.37E-01 (Median)	Methylation in Control	9.40E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in prostate cancer			[ 11 ]
Location	TSS1500 (cg04593696)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.51E+00	Statistic Test	p-value: 1.82E-02; Z-score: 6.77E+00
Methylation in Case	7.34E-01 (Median)	Methylation in Control	4.85E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in prostate cancer			[ 11 ]
Location	TSS200 (cg06748231)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 1.31E-02; Z-score: 2.30E+00
Methylation in Case	6.72E-02 (Median)	Methylation in Control	5.55E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in prostate cancer			[ 11 ]
Location	Body (cg18749411)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.10E-03; Z-score: 3.77E+00
Methylation in Case	9.36E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in prostate cancer			[ 11 ]
Location	Body (cg09298971)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.58E+00	Statistic Test	p-value: 9.22E-03; Z-score: -3.78E+00
Methylation in Case	4.11E-01 (Median)	Methylation in Control	6.48E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in prostate cancer			[ 11 ]
Location	Body (cg13551505)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 1.03E-02; Z-score: -7.30E+00
Methylation in Case	5.41E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in prostate cancer			[ 11 ]
Location	Body (cg26410105)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 3.92E-02; Z-score: 2.07E+00
Methylation in Case	8.36E-02 (Median)	Methylation in Control	6.56E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in prostate cancer			[ 11 ]
Location	Body (cg00874873)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 4.05E-02; Z-score: 2.20E+00
Methylation in Case	9.52E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in depression			[ 12 ]
Location	TSS200 (cg23834895)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.43E-02; Z-score: 4.61E-01
Methylation in Case	2.91E-01 (Median)	Methylation in Control	2.67E-01 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in systemic lupus erythematosus			[ 13 ]
Location	TSS200 (cg16644457)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 3.42E-02; Z-score: 2.84E-01
Methylation in Case	1.36E-01 (Median)	Methylation in Control	1.26E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in systemic lupus erythematosus			[ 13 ]
Location	Body (cg20809470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 4.11E-02; Z-score: -2.51E-01
Methylation in Case	1.95E-01 (Median)	Methylation in Control	2.05E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	Body (cg04583232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 8.87E-04; Z-score: -6.94E-01
Methylation in Case	5.79E-01 (Median)	Methylation in Control	6.49E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	Body (cg04954559)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 1.03E-03; Z-score: -7.63E-01
Methylation in Case	8.81E-01 (Median)	Methylation in Control	9.07E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	Body (cg09150064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 9.38E-03; Z-score: 4.09E-01
Methylation in Case	6.63E-01 (Median)	Methylation in Control	6.12E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	3'UTR (cg25335435)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 1.85E-09; Z-score: -1.66E+00
Methylation in Case	3.43E-01 (Median)	Methylation in Control	5.52E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Renal cell carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC17A6 in clear cell renal cell carcinoma			[ 15 ]
Location	Body (cg04583232)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.00E+00	Statistic Test	p-value: 2.00E-12; Z-score: 4.54E+00
Methylation in Case	3.26E-01 (Median)	Methylation in Control	1.63E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC17A6 in clear cell renal cell carcinoma			[ 15 ]
Location	Body (cg24454829)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.74E+00	Statistic Test	p-value: 1.02E-07; Z-score: 3.02E+00
Methylation in Case	2.68E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC17A6 in clear cell renal cell carcinoma			[ 15 ]
Location	Body (cg21518089)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.55E+00	Statistic Test	p-value: 1.11E-05; Z-score: 2.55E+00
Methylation in Case	2.00E-01 (Median)	Methylation in Control	1.29E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC17A6 in clear cell renal cell carcinoma			[ 15 ]
Location	Body (cg22371972)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.55E+00	Statistic Test	p-value: 9.29E-04; Z-score: 2.55E+00
Methylation in Case	4.38E-02 (Median)	Methylation in Control	2.82E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC17A6 in clear cell renal cell carcinoma			[ 15 ]
Location	Body (cg24151995)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 4.50E-03; Z-score: 4.74E-01
Methylation in Case	1.03E-01 (Median)	Methylation in Control	9.18E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC17A6 in clear cell renal cell carcinoma			[ 15 ]
Location	Body (cg09150064)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.81E-02; Z-score: -1.47E-02
Methylation in Case	7.95E-02 (Median)	Methylation in Control	8.08E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC17A6 in clear cell renal cell carcinoma			[ 15 ]
Location	Body (cg16079774)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.26E+00	Statistic Test	p-value: 4.40E-02; Z-score: 6.03E-01
Methylation in Case	2.29E-02 (Median)	Methylation in Control	1.82E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-26b directly targets SLC17A6			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-26b	miRNA Mature ID	miR-26b-5p
miRNA Sequence	UUCAAGUAAUUCAGGAUAGGU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)

References
1	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3	DNA Methylation Dynamics in Urological Tumors.
4	Genome-wide Scan for Methylation Profiles in Breast Cancer
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
10	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
15	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
16	MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence