Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0120 Transporter Info | ||||
| Gene Name | SLC17A7 | ||||
| Transporter Name | Vesicular glutamate transporter 1 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg21557108) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.37E+00 | Statistic Test | p-value: 1.16E-08; Z-score: -2.46E+00 | ||
|
Methylation in Case |
4.79E-01 (Median) | Methylation in Control | 6.55E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg04721098) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.50E+00 | Statistic Test | p-value: 2.66E-07; Z-score: -3.47E+00 | ||
|
Methylation in Case |
3.89E-01 (Median) | Methylation in Control | 5.84E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg22815214) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 3.69E-03; Z-score: -1.25E+00 | ||
|
Methylation in Case |
2.71E-01 (Median) | Methylation in Control | 3.68E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg23405575) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.76E+00 | Statistic Test | p-value: 1.37E-06; Z-score: 6.06E+00 | ||
|
Methylation in Case |
5.27E-01 (Median) | Methylation in Control | 1.91E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg02772823) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 7.92E-06; Z-score: -1.14E+00 | ||
|
Methylation in Case |
3.08E-01 (Median) | Methylation in Control | 4.03E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg24565369) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.05E+00 | Statistic Test | p-value: 1.25E-05; Z-score: 4.53E+00 | ||
|
Methylation in Case |
4.78E-01 (Median) | Methylation in Control | 1.18E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg03364832) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 2.83E-06; Z-score: -2.92E+00 | ||
|
Methylation in Case |
5.02E-01 (Median) | Methylation in Control | 6.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg05808709) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 8.52E-06; Z-score: -6.03E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg13154880) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.10E-05; Z-score: 1.31E+00 | ||
|
Methylation in Case |
3.87E-01 (Median) | Methylation in Control | 3.11E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg15677087) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 1.24E-05; Z-score: -3.95E+00 | ||
|
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 7.99E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg20307184) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.42E-05; Z-score: -3.88E+00 | ||
|
Methylation in Case |
6.42E-01 (Median) | Methylation in Control | 7.92E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg00087511) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.26E-04; Z-score: -1.71E+00 | ||
|
Methylation in Case |
6.86E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg10029905) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 3.42E-04; Z-score: -1.74E+00 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg13359765) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 1.06E-03; Z-score: -1.29E+00 | ||
|
Methylation in Case |
2.82E-01 (Median) | Methylation in Control | 3.35E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg11975793) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 4.27E-03; Z-score: 5.79E-01 | ||
|
Methylation in Case |
7.83E-01 (Median) | Methylation in Control | 7.28E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC17A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg06581825) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 1.72E-04; Z-score: -1.41E+00 | ||
|
Methylation in Case |
4.66E-01 (Median) | Methylation in Control | 5.76E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg17398613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 8.94E-04; Z-score: -9.88E-01 | ||
|
Methylation in Case |
7.42E-01 (Median) | Methylation in Control | 7.91E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg16907029) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 7.84E-03; Z-score: 2.91E-01 | ||
|
Methylation in Case |
4.31E-01 (Median) | Methylation in Control | 4.26E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg09993849) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.29E-02; Z-score: -6.61E-01 | ||
|
Methylation in Case |
9.43E-02 (Median) | Methylation in Control | 1.07E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg16693612) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 6.00E-05; Z-score: -9.36E-01 | ||
|
Methylation in Case |
3.55E-01 (Median) | Methylation in Control | 3.97E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg11999255) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 8.86E-03; Z-score: -1.04E+00 | ||
|
Methylation in Case |
3.22E-01 (Median) | Methylation in Control | 3.81E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg19980771) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 4.83E-10; Z-score: 1.96E+00 | ||
|
Methylation in Case |
5.45E-01 (Median) | Methylation in Control | 3.78E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg05055652) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 5.83E-04; Z-score: 8.12E-01 | ||
|
Methylation in Case |
1.07E-01 (Median) | Methylation in Control | 9.02E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg00662647) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 3.37E-16; Z-score: 9.28E-01 | ||
|
Methylation in Case |
6.17E-02 (Median) | Methylation in Control | 4.40E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg10655629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 6.77E-13; Z-score: 2.41E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 5.82E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg14655994) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 5.20E-05; Z-score: 1.29E+00 | ||
|
Methylation in Case |
6.62E-01 (Median) | Methylation in Control | 5.66E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg13410755) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 8.76E-04; Z-score: -7.91E-01 | ||
|
Methylation in Case |
1.09E-01 (Median) | Methylation in Control | 1.24E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg23970089) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.21E-03; Z-score: -4.91E-01 | ||
|
Methylation in Case |
1.14E-01 (Median) | Methylation in Control | 1.27E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg21907993) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.28E-03; Z-score: 4.78E-01 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg17207736) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 2.47E-03; Z-score: 8.22E-01 | ||
|
Methylation in Case |
7.80E-01 (Median) | Methylation in Control | 7.07E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg03763950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.87E-02; Z-score: -4.45E-01 | ||
|
Methylation in Case |
6.28E-02 (Median) | Methylation in Control | 6.85E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg03825810) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 2.06E-04; Z-score: -1.10E+00 | ||
|
Methylation in Case |
5.98E-01 (Median) | Methylation in Control | 7.20E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC17A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg10876737) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.98E-02; Z-score: -3.28E-01 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in prostate cancer | [ 3 ] | |||
|
Location |
5'UTR (cg26590537) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.06E+00 | Statistic Test | p-value: 2.68E-02; Z-score: 9.39E+00 | ||
|
Methylation in Case |
3.61E-01 (Median) | Methylation in Control | 1.18E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in prostate cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg24040450) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.62E+00 | Statistic Test | p-value: 2.52E-02; Z-score: -3.44E+00 | ||
|
Methylation in Case |
4.75E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in prostate cancer | [ 3 ] | |||
|
Location |
Body (cg15821546) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 1.16E-02; Z-score: -4.80E+00 | ||
|
Methylation in Case |
3.56E-01 (Median) | Methylation in Control | 5.48E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in prostate cancer | [ 3 ] | |||
|
Location |
Body (cg02490934) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.93E-02; Z-score: 2.28E+00 | ||
|
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 7.22E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in prostate cancer | [ 3 ] | |||
|
Location |
Body (cg15115583) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 4.53E-02; Z-score: 4.00E+00 | ||
|
Methylation in Case |
7.32E-02 (Median) | Methylation in Control | 5.22E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
21 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg01273580) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 4.92E-03; Z-score: 5.92E-01 | ||
|
Methylation in Case |
1.01E-01 (Median) | Methylation in Control | 8.11E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg16829998) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.56E+00 | Statistic Test | p-value: 2.08E-10; Z-score: 2.23E+00 | ||
|
Methylation in Case |
1.67E-01 (Median) | Methylation in Control | 1.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg04378167) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 2.73E-08; Z-score: 1.36E+00 | ||
|
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 8.83E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg08460548) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 4.81E-03; Z-score: 5.65E-01 | ||
|
Methylation in Case |
8.17E-02 (Median) | Methylation in Control | 7.24E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg15114105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 1.14E-02; Z-score: 3.92E-01 | ||
|
Methylation in Case |
3.50E-02 (Median) | Methylation in Control | 2.78E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
TSS200 (cg22364668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 2.26E-02; Z-score: 3.60E-01 | ||
|
Methylation in Case |
2.42E-02 (Median) | Methylation in Control | 1.93E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg20152891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.95E+00 | Statistic Test | p-value: 2.25E-11; Z-score: 2.17E+00 | ||
|
Methylation in Case |
2.15E-01 (Median) | Methylation in Control | 1.10E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg08374499) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+00 | Statistic Test | p-value: 3.69E-10; Z-score: -1.97E+00 | ||
|
Methylation in Case |
4.39E-01 (Median) | Methylation in Control | 6.78E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg17789138) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 4.36E-07; Z-score: -1.72E+00 | ||
|
Methylation in Case |
3.64E-01 (Median) | Methylation in Control | 5.31E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg03138668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 1.62E-06; Z-score: 1.88E+00 | ||
|
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 7.58E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg16890796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 6.19E-06; Z-score: -1.49E+00 | ||
|
Methylation in Case |
4.61E-01 (Median) | Methylation in Control | 5.50E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg11317158) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 9.11E-04; Z-score: -7.25E-01 | ||
|
Methylation in Case |
8.78E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg02881274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 9.75E-04; Z-score: -7.74E-01 | ||
|
Methylation in Case |
4.92E-01 (Median) | Methylation in Control | 5.28E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg23409374) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 2.04E-03; Z-score: 4.88E-01 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 7.99E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg02624701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 3.65E-03; Z-score: -7.19E-01 | ||
|
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 7.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg20979061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 6.52E-03; Z-score: 4.19E-01 | ||
|
Methylation in Case |
5.26E-01 (Median) | Methylation in Control | 5.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg00740822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 6.96E-03; Z-score: -9.03E-01 | ||
|
Methylation in Case |
4.75E-01 (Median) | Methylation in Control | 5.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg14767950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 2.47E-02; Z-score: -5.16E-01 | ||
|
Methylation in Case |
1.68E-01 (Median) | Methylation in Control | 1.83E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg11306735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.10E-02; Z-score: -6.42E-01 | ||
|
Methylation in Case |
4.59E-01 (Median) | Methylation in Control | 5.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
Body (cg02288564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.04E-02; Z-score: -2.18E-01 | ||
|
Methylation in Case |
9.65E-01 (Median) | Methylation in Control | 9.68E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC17A7 in breast cancer | [ 4 ] | |||
|
Location |
3'UTR (cg18150383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.98E-13; Z-score: -2.79E+00 | ||
|
Methylation in Case |
7.94E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
23 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg01273580) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.56E-02; Z-score: -4.55E-01 | ||
|
Methylation in Case |
1.16E-01 (Median) | Methylation in Control | 1.31E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg08460548) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 5.94E-03; Z-score: 3.62E-01 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 9.90E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg15114105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 6.30E-03; Z-score: -2.27E-02 | ||
|
Methylation in Case |
2.10E-02 (Median) | Methylation in Control | 2.12E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
TSS200 (cg22364668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.75E-02; Z-score: 3.51E-01 | ||
|
Methylation in Case |
1.66E-02 (Median) | Methylation in Control | 1.56E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg16909495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 2.59E-10; Z-score: 2.97E+00 | ||
|
Methylation in Case |
6.82E-01 (Median) | Methylation in Control | 5.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg19063061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.39E+00 | Statistic Test | p-value: 7.85E-10; Z-score: 5.46E+00 | ||
|
Methylation in Case |
3.43E-01 (Median) | Methylation in Control | 1.01E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg11306735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 1.37E-09; Z-score: -2.37E+00 | ||
|
Methylation in Case |
6.64E-01 (Median) | Methylation in Control | 7.84E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg20979061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 1.39E-09; Z-score: 1.92E+00 | ||
|
Methylation in Case |
6.46E-01 (Median) | Methylation in Control | 4.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg08374499) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 1.75E-08; Z-score: -2.30E+00 | ||
|
Methylation in Case |
5.81E-01 (Median) | Methylation in Control | 7.09E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg15164708) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 5.31E-08; Z-score: 1.93E+00 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg16890796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 1.34E-07; Z-score: 2.10E+00 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 4.91E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg00392377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 2.52E-07; Z-score: 1.72E+00 | ||
|
Methylation in Case |
5.12E-01 (Median) | Methylation in Control | 4.00E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg22231400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.56E+00 | Statistic Test | p-value: 4.85E-07; Z-score: 1.35E+00 | ||
|
Methylation in Case |
3.49E-01 (Median) | Methylation in Control | 2.25E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg02624701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 5.60E-07; Z-score: 1.42E+00 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 5.51E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg14767950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.15E-06; Z-score: 1.10E+00 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 2.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg02881274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 1.16E-06; Z-score: 2.08E+00 | ||
|
Methylation in Case |
5.39E-01 (Median) | Methylation in Control | 4.31E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg00740822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 4.70E-06; Z-score: 2.39E+00 | ||
|
Methylation in Case |
3.54E-01 (Median) | Methylation in Control | 2.52E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg17789138) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.04E-04; Z-score: 8.86E-01 | ||
|
Methylation in Case |
4.53E-01 (Median) | Methylation in Control | 3.90E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg20152891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.26E+00 | Statistic Test | p-value: 4.14E-04; Z-score: 1.20E+00 | ||
|
Methylation in Case |
1.97E-01 (Median) | Methylation in Control | 1.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg03138668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 7.05E-03; Z-score: -3.62E-01 | ||
|
Methylation in Case |
1.73E-01 (Median) | Methylation in Control | 1.83E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
Body (cg02615582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.65E-02; Z-score: 1.19E+00 | ||
|
Methylation in Case |
8.08E-01 (Median) | Methylation in Control | 7.62E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC17A7 in colorectal cancer | [ 5 ] | |||
|
Location |
3'UTR (cg18150383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.87E-05; Z-score: -2.28E+00 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS1500 (cg01592801) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.12E+00 | Statistic Test | p-value: 1.74E-16; Z-score: 4.62E+00 | ||
|
Methylation in Case |
6.04E-01 (Median) | Methylation in Control | 2.85E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
TSS200 (cg08586500) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 4.15E-11; Z-score: -1.96E+00 | ||
|
Methylation in Case |
2.31E-01 (Median) | Methylation in Control | 3.15E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
1stExon (cg08209133) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.68E+00 | Statistic Test | p-value: 6.53E-12; Z-score: 4.11E+00 | ||
|
Methylation in Case |
3.79E-01 (Median) | Methylation in Control | 2.26E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02071798) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 3.26E-21; Z-score: -3.67E+00 | ||
|
Methylation in Case |
6.00E-01 (Median) | Methylation in Control | 7.74E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg05394840) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 2.48E-17; Z-score: -8.72E+00 | ||
|
Methylation in Case |
5.31E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg25585043) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 5.68E-15; Z-score: -2.72E+00 | ||
|
Methylation in Case |
4.31E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02906784) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.52E+00 | Statistic Test | p-value: 1.01E-14; Z-score: -4.06E+00 | ||
|
Methylation in Case |
3.97E-01 (Median) | Methylation in Control | 6.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg19991383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.44E+00 | Statistic Test | p-value: 2.93E-13; Z-score: -4.93E+00 | ||
|
Methylation in Case |
5.30E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg19923238) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 2.94E-10; Z-score: -2.48E+00 | ||
|
Methylation in Case |
7.49E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg11799480) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 5.01E-10; Z-score: -2.71E+00 | ||
|
Methylation in Case |
5.00E-01 (Median) | Methylation in Control | 5.85E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg17379325) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.82E+00 | Statistic Test | p-value: 1.09E-09; Z-score: 3.44E+00 | ||
|
Methylation in Case |
3.50E-01 (Median) | Methylation in Control | 1.92E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg11317158) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 3.10E-08; Z-score: -1.72E+00 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg00740822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 5.24E-08; Z-score: 2.49E+00 | ||
|
Methylation in Case |
4.21E-01 (Median) | Methylation in Control | 3.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02624701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 6.42E-08; Z-score: 2.72E+00 | ||
|
Methylation in Case |
6.38E-01 (Median) | Methylation in Control | 4.44E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg20979061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 9.03E-07; Z-score: 1.27E+00 | ||
|
Methylation in Case |
4.00E-01 (Median) | Methylation in Control | 3.30E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg03282345) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 2.16E-05; Z-score: 1.57E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02288564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.34E-04; Z-score: -1.02E+00 | ||
|
Methylation in Case |
9.27E-01 (Median) | Methylation in Control | 9.58E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg23409374) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 5.22E-04; Z-score: 9.46E-01 | ||
|
Methylation in Case |
8.53E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg20152891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 5.92E-04; Z-score: 1.03E+00 | ||
|
Methylation in Case |
2.71E-01 (Median) | Methylation in Control | 2.17E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg22231400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 1.78E-03; Z-score: 1.59E+00 | ||
|
Methylation in Case |
4.86E-01 (Median) | Methylation in Control | 3.62E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg00392377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 3.85E-03; Z-score: 4.22E-01 | ||
|
Methylation in Case |
2.07E-01 (Median) | Methylation in Control | 1.96E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg17789138) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 4.38E-03; Z-score: -1.18E+00 | ||
|
Methylation in Case |
1.93E-01 (Median) | Methylation in Control | 2.37E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02615582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.80E-03; Z-score: -7.18E-01 | ||
|
Methylation in Case |
5.63E-01 (Median) | Methylation in Control | 5.96E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg03138668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 8.48E-03; Z-score: -1.96E-01 | ||
|
Methylation in Case |
1.05E-01 (Median) | Methylation in Control | 1.09E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg02881274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 1.18E-02; Z-score: 1.35E+00 | ||
|
Methylation in Case |
3.54E-01 (Median) | Methylation in Control | 2.94E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC17A7 in hepatocellular carcinoma | [ 6 ] | |||
|
Location |
Body (cg16890796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 3.60E-02; Z-score: -7.74E-01 | ||
|
Methylation in Case |
2.32E-01 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
TSS1500 (cg01273580) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 3.24E-02; Z-score: 5.51E-01 | ||
|
Methylation in Case |
2.23E-01 (Median) | Methylation in Control | 1.89E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg22231400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.80E+00 | Statistic Test | p-value: 2.50E-08; Z-score: 2.40E+00 | ||
|
Methylation in Case |
2.80E-01 (Median) | Methylation in Control | 1.55E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg19063061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.47E+00 | Statistic Test | p-value: 1.33E-07; Z-score: 3.33E+00 | ||
|
Methylation in Case |
1.96E-01 (Median) | Methylation in Control | 7.94E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg20979061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 1.83E-06; Z-score: 1.74E+00 | ||
|
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 3.17E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg02881274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 2.49E-04; Z-score: 9.32E-01 | ||
|
Methylation in Case |
2.63E-01 (Median) | Methylation in Control | 2.31E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg16909495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 3.00E-04; Z-score: 1.35E+00 | ||
|
Methylation in Case |
3.00E-01 (Median) | Methylation in Control | 2.34E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg00740822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 4.00E-04; Z-score: 1.18E+00 | ||
|
Methylation in Case |
2.03E-01 (Median) | Methylation in Control | 1.52E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg15164708) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.27E-03; Z-score: 8.17E-01 | ||
|
Methylation in Case |
2.90E-01 (Median) | Methylation in Control | 2.61E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg00392377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 2.00E-03; Z-score: 9.44E-01 | ||
|
Methylation in Case |
2.14E-01 (Median) | Methylation in Control | 1.89E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg20152891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.35E+00 | Statistic Test | p-value: 8.11E-03; Z-score: 9.36E-01 | ||
|
Methylation in Case |
2.43E-01 (Median) | Methylation in Control | 1.79E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in HIV infection | [ 7 ] | |||
|
Location |
Body (cg11306735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 4.00E-02; Z-score: -5.57E-01 | ||
|
Methylation in Case |
7.91E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
TSS200 (cg08460548) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 7.00E-03; Z-score: -2.05E+00 | ||
|
Methylation in Case |
7.68E-02 (Median) | Methylation in Control | 8.68E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
TSS200 (cg04378167) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.75E+00 | Statistic Test | p-value: 2.63E-02; Z-score: -1.82E+00 | ||
|
Methylation in Case |
5.19E-02 (Median) | Methylation in Control | 9.08E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg15164708) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.03E+00 | Statistic Test | p-value: 9.13E-10; Z-score: 2.34E+01 | ||
|
Methylation in Case |
5.18E-01 (Median) | Methylation in Control | 2.55E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg08374499) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.92E+00 | Statistic Test | p-value: 4.42E-09; Z-score: -8.05E+00 | ||
|
Methylation in Case |
2.92E-01 (Median) | Methylation in Control | 5.62E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg11306735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.79E+00 | Statistic Test | p-value: 1.31E-07; Z-score: -1.31E+01 | ||
|
Methylation in Case |
3.83E-01 (Median) | Methylation in Control | 6.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg20979061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.63E+00 | Statistic Test | p-value: 4.26E-06; Z-score: 4.71E+00 | ||
|
Methylation in Case |
5.10E-01 (Median) | Methylation in Control | 3.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg02624701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.80E+00 | Statistic Test | p-value: 7.16E-04; Z-score: 6.23E+00 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 3.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg11317158) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.23E-03; Z-score: -4.41E+00 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg00392377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 1.57E-03; Z-score: 4.90E+00 | ||
|
Methylation in Case |
2.27E-01 (Median) | Methylation in Control | 1.79E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg02615582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 3.36E-03; Z-score: 7.48E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 5.41E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg22231400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+00 | Statistic Test | p-value: 9.01E-03; Z-score: -3.65E+00 | ||
|
Methylation in Case |
2.69E-01 (Median) | Methylation in Control | 4.17E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg14767950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 1.40E-02; Z-score: 8.35E-01 | ||
|
Methylation in Case |
1.33E-01 (Median) | Methylation in Control | 1.25E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg03282345) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 3.04E-02; Z-score: 1.85E+00 | ||
|
Methylation in Case |
6.55E-01 (Median) | Methylation in Control | 5.76E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg23409374) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 4.08E-02; Z-score: 2.64E+00 | ||
|
Methylation in Case |
7.89E-01 (Median) | Methylation in Control | 6.83E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
Body (cg16890796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 4.83E-02; Z-score: 1.89E+00 | ||
|
Methylation in Case |
3.61E-01 (Median) | Methylation in Control | 2.60E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC17A7 in bladder cancer | [ 8 ] | |||
|
Location |
3'UTR (cg18150383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 1.12E-06; Z-score: -1.17E+01 | ||
|
Methylation in Case |
6.38E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
TSS200 (cg08460548) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 2.57E-02; Z-score: 5.22E-01 | ||
|
Methylation in Case |
5.19E-02 (Median) | Methylation in Control | 4.75E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg20979061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.88E+00 | Statistic Test | p-value: 7.46E-12; Z-score: 2.44E+00 | ||
|
Methylation in Case |
4.04E-01 (Median) | Methylation in Control | 2.15E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg08374499) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 2.73E-08; Z-score: -2.85E+00 | ||
|
Methylation in Case |
6.90E-01 (Median) | Methylation in Control | 8.03E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg19063061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.61E+00 | Statistic Test | p-value: 1.12E-06; Z-score: 1.79E+00 | ||
|
Methylation in Case |
2.10E-01 (Median) | Methylation in Control | 5.81E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg20152891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.79E+00 | Statistic Test | p-value: 2.75E-06; Z-score: 2.56E+00 | ||
|
Methylation in Case |
1.46E-01 (Median) | Methylation in Control | 8.16E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg00392377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 1.15E-05; Z-score: 9.10E-01 | ||
|
Methylation in Case |
2.02E-01 (Median) | Methylation in Control | 1.57E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg03282345) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.20E-05; Z-score: 1.87E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 6.90E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg16909495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 1.78E-05; Z-score: 1.64E+00 | ||
|
Methylation in Case |
3.38E-01 (Median) | Methylation in Control | 2.37E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg02624701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 2.12E-05; Z-score: 1.48E+00 | ||
|
Methylation in Case |
4.32E-01 (Median) | Methylation in Control | 3.11E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg02881274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.54E+00 | Statistic Test | p-value: 2.13E-05; Z-score: 1.58E+00 | ||
|
Methylation in Case |
3.78E-01 (Median) | Methylation in Control | 2.46E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg03138668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 2.74E-05; Z-score: 1.16E+00 | ||
|
Methylation in Case |
5.91E-02 (Median) | Methylation in Control | 4.40E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg15164708) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 8.57E-04; Z-score: 1.31E+00 | ||
|
Methylation in Case |
3.37E-01 (Median) | Methylation in Control | 2.72E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg22231400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.49E+00 | Statistic Test | p-value: 1.23E-03; Z-score: 1.59E+00 | ||
|
Methylation in Case |
4.43E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg02288564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.97E-03; Z-score: 1.85E+00 | ||
|
Methylation in Case |
9.75E-01 (Median) | Methylation in Control | 9.23E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg14767950) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 6.86E-03; Z-score: 5.65E-01 | ||
|
Methylation in Case |
7.73E-02 (Median) | Methylation in Control | 6.79E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC17A7 in clear cell renal cell carcinoma | [ 9 ] | |||
|
Location |
Body (cg16890796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 2.93E-02; Z-score: 7.88E-01 | ||
|
Methylation in Case |
3.21E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in depression | [ 10 ] | |||
|
Location |
TSS200 (cg08460548) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 4.85E-02; Z-score: 2.54E-01 | ||
|
Methylation in Case |
7.66E-02 (Median) | Methylation in Control | 7.43E-02 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in depression | [ 10 ] | |||
|
Location |
Body (cg00740822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.57E-02; Z-score: 3.92E-01 | ||
|
Methylation in Case |
2.04E-01 (Median) | Methylation in Control | 1.93E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in depression | [ 10 ] | |||
|
Location |
Body (cg16890796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 3.26E-02; Z-score: -5.02E-01 | ||
|
Methylation in Case |
2.00E-01 (Median) | Methylation in Control | 2.14E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
6 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
TSS200 (cg04378167) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 3.00E-02; Z-score: -1.39E+00 | ||
|
Methylation in Case |
1.22E-01 (Median) | Methylation in Control | 1.88E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg19063061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 7.47E-05; Z-score: 1.11E+00 | ||
|
Methylation in Case |
2.56E-01 (Median) | Methylation in Control | 2.05E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg20979061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 4.70E-03; Z-score: 8.85E-01 | ||
|
Methylation in Case |
3.08E-01 (Median) | Methylation in Control | 2.71E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg02624701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 5.53E-03; Z-score: 3.00E-01 | ||
|
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 3.83E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg00392377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 6.54E-03; Z-score: 4.94E-01 | ||
|
Methylation in Case |
1.46E-01 (Median) | Methylation in Control | 1.34E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in papillary thyroid cancer | [ 11 ] | |||
|
Location |
Body (cg02288564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 3.59E-02; Z-score: 5.90E-01 | ||
|
Methylation in Case |
9.41E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
TSS200 (cg08460548) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.88E-03; Z-score: -2.20E-01 | ||
|
Methylation in Case |
1.09E-01 (Median) | Methylation in Control | 1.14E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
TSS200 (cg15114105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.52E-02; Z-score: -2.17E-01 | ||
|
Methylation in Case |
4.06E-02 (Median) | Methylation in Control | 4.56E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg02624701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 7.24E-03; Z-score: 1.15E-01 | ||
|
Methylation in Case |
3.93E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg23409374) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.12E-02; Z-score: 8.78E-02 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg02288564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.14E-02; Z-score: 8.81E-02 | ||
|
Methylation in Case |
9.65E-01 (Median) | Methylation in Control | 9.63E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg15164708) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.20E-02; Z-score: 3.07E-01 | ||
|
Methylation in Case |
3.59E-01 (Median) | Methylation in Control | 3.44E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg11317158) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.96E-02; Z-score: -1.19E-01 | ||
|
Methylation in Case |
9.18E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in systemic lupus erythematosus | [ 12 ] | |||
|
Location |
Body (cg03282345) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.50E-02; Z-score: 1.24E-01 | ||
|
Methylation in Case |
6.76E-01 (Median) | Methylation in Control | 6.68E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg00392377) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 2.39E-05; Z-score: 1.18E+00 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 6.53E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg00740822) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 3.69E-05; Z-score: -1.06E+00 | ||
|
Methylation in Case |
5.56E-01 (Median) | Methylation in Control | 7.07E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02288564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.40E-04; Z-score: -9.13E-01 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 7.99E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02615582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 1.91E-04; Z-score: 8.05E-01 | ||
|
Methylation in Case |
7.50E-01 (Median) | Methylation in Control | 6.25E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02624701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.49E+00 | Statistic Test | p-value: 1.91E-04; Z-score: 1.33E+00 | ||
|
Methylation in Case |
4.40E-01 (Median) | Methylation in Control | 2.96E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02881274) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 2.33E-04; Z-score: 7.47E-01 | ||
|
Methylation in Case |
6.49E-01 (Median) | Methylation in Control | 5.51E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg03138668) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 2.57E-04; Z-score: 9.79E-01 | ||
|
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 6.92E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg03282345) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 2.81E-04; Z-score: 7.12E-01 | ||
|
Methylation in Case |
1.22E-01 (Median) | Methylation in Control | 1.05E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg08374499) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 5.90E-03; Z-score: -2.56E-01 | ||
|
Methylation in Case |
6.52E-01 (Median) | Methylation in Control | 6.79E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg11306735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.12E-02; Z-score: 4.26E-01 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg11317158) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 2.13E-02; Z-score: -4.03E-01 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 7.63E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC17A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg18150383) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 1.42E-10; Z-score: -1.93E+00 | ||
|
Methylation in Case |
5.26E-01 (Median) | Methylation in Control | 6.67E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg20979061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 1.03E-04; Z-score: 2.64E+00 | ||
|
Methylation in Case |
4.59E-01 (Median) | Methylation in Control | 3.18E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg20152891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 1.91E-03; Z-score: 2.03E+00 | ||
|
Methylation in Case |
2.82E-01 (Median) | Methylation in Control | 2.01E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg02624701) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 5.45E-03; Z-score: 1.77E+00 | ||
|
Methylation in Case |
5.60E-01 (Median) | Methylation in Control | 4.18E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg23409374) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 6.80E-03; Z-score: 1.09E+00 | ||
|
Methylation in Case |
7.86E-01 (Median) | Methylation in Control | 7.49E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg19063061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.99E+00 | Statistic Test | p-value: 1.08E-02; Z-score: 4.48E+00 | ||
|
Methylation in Case |
2.70E-01 (Median) | Methylation in Control | 1.35E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16909495) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 1.17E-02; Z-score: 1.73E+00 | ||
|
Methylation in Case |
4.22E-01 (Median) | Methylation in Control | 3.07E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg03282345) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.87E-02; Z-score: 3.28E+00 | ||
|
Methylation in Case |
6.76E-01 (Median) | Methylation in Control | 6.26E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg15164708) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.38E+00 | Statistic Test | p-value: 2.73E-02; Z-score: 1.20E+00 | ||
|
Methylation in Case |
4.17E-01 (Median) | Methylation in Control | 3.03E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg02615582) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 3.32E-02; Z-score: 1.06E+00 | ||
|
Methylation in Case |
7.16E-01 (Median) | Methylation in Control | 6.53E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16890796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.40E+00 | Statistic Test | p-value: 4.16E-02; Z-score: 1.47E+00 | ||
|
Methylation in Case |
4.17E-01 (Median) | Methylation in Control | 2.98E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg22231400) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 4.41E-02; Z-score: 1.48E+00 | ||
|
Methylation in Case |
3.56E-01 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC17A7 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg11306735) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.79E-02; Z-score: -1.65E+00 | ||
|
Methylation in Case |
6.71E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC17A7 in panic disorder | [ 15 ] | |||
|
Location |
Body (cg17789138) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 9.61E-01 | Statistic Test | p-value: 4.25E-02; Z-score: 2.12E-01 | ||
|
Methylation in Case |
-2.42E+00 (Median) | Methylation in Control | -2.52E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC17A7 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.78E-11; Fold-change: 0.452276278; Z-score: 17.25379801 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
microRNA |
|||||
|
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-335 directly targets SLC17A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
|
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
|
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.