Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0121 Transporter Info | ||||
| Gene Name | SLC17A8 | ||||
| Transporter Name | Vesicular glutamate transporter 3 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-100 directly targets SLC17A8 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-100 | miRNA Mature ID | miR-100-5p | ||
|
miRNA Sequence |
AACCCGUAGAUCCGAACUUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Methylation |
|||||
|
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC17A8 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.13E-05; Fold-change: 0.206356653; Z-score: 5.955051648 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Craniopharyngioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC17A8 in craniopharyngioma than that in healthy individual | ||||
Studied Phenotype |
Craniopharyngioma [ICD-11:2F9A] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 9.72E-08; Fold-change: -0.251986396; Z-score: -1.941974637 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Diffuse midline glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC17A8 in diffuse midline glioma than that in healthy individual | ||||
Studied Phenotype |
Diffuse midline glioma [ICD-11:2A00.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.78E-18; Fold-change: -0.226300368; Z-score: -1.713072383 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Glioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC17A8 in glioblastoma than that in healthy individual | ||||
Studied Phenotype |
Glioblastoma [ICD-11:2A00.00] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.55E-08; Fold-change: -0.225759004; Z-score: -1.74236056 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Esthesioneuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC17A8 in esthesioneuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Esthesioneuroblastoma [ICD-11:2D50.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.84E-07; Fold-change: -0.337205853; Z-score: -2.583806217 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
| References | |||||
|---|---|---|---|---|---|
| 1 | Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65. | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.