Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0126 Transporter Info
Gene Name	SLC19A1
Transporter Name	Folate transporter 1
Gene ID	6573
UniProt ID	P41440

Epigenetic Regulations of This DT (EGR)
Methylation
Atypical teratoid rhabdoid tumor	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg03721454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 1.90E-08; Z-score: -1.44E+00
Methylation in Case	5.47E-01 (Median)	Methylation in Control	7.17E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg06731865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.37E+00	Statistic Test	p-value: 6.96E-08; Z-score: 1.59E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	5.50E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg15725933)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.54E-06; Z-score: -1.15E+00
Methylation in Case	7.05E-01 (Median)	Methylation in Control	7.88E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg18035534)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.47E+00	Statistic Test	p-value: 2.28E-06; Z-score: 1.53E+00
Methylation in Case	7.29E-01 (Median)	Methylation in Control	4.96E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	5'UTR (cg18353345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 2.47E-06; Z-score: -1.02E+00
Methylation in Case	4.91E-01 (Median)	Methylation in Control	6.66E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg00714531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 3.45E-05; Z-score: 4.68E-01
Methylation in Case	1.91E-01 (Median)	Methylation in Control	1.66E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg03031182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.49E-04; Z-score: 7.86E-01
Methylation in Case	8.68E-01 (Median)	Methylation in Control	7.68E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg04307902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -3.32E+00	Statistic Test	p-value: 6.84E-04; Z-score: -3.54E-01
Methylation in Case	2.75E-02 (Median)	Methylation in Control	9.11E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg07844507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 5.00E-03; Z-score: 5.35E-02
Methylation in Case	1.61E-01 (Median)	Methylation in Control	1.57E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	Body (cg07996352)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 5.22E-03; Z-score: -9.30E-01
Methylation in Case	2.61E-01 (Median)	Methylation in Control	3.10E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC19A1 in atypical teratoid rhabdoid tumor			[ 1 ]
Location	3'UTR (cg22991943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 7.61E-10; Z-score: -1.65E+00
Methylation in Case	5.60E-01 (Median)	Methylation in Control	7.33E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Bladder cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg18035534)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 2.59E-09; Z-score: -1.99E+01
Methylation in Case	5.76E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg03721454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 6.77E-04; Z-score: 4.92E+00
Methylation in Case	6.57E-01 (Median)	Methylation in Control	5.28E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	5'UTR (cg06731865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 6.91E-04; Z-score: -3.04E+00
Methylation in Case	7.58E-01 (Median)	Methylation in Control	8.18E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	TSS1500 (cg17243364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 1.60E-07; Z-score: -7.42E+00
Methylation in Case	1.55E-01 (Median)	Methylation in Control	1.99E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	TSS200 (cg10119313)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.48E+00	Statistic Test	p-value: 1.82E-03; Z-score: -2.48E+00
Methylation in Case	3.51E-02 (Median)	Methylation in Control	5.19E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	TSS200 (cg11940663)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 3.80E-02; Z-score: -1.06E+00
Methylation in Case	3.20E-02 (Median)	Methylation in Control	4.26E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	Body (cg17803589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.80E+00	Statistic Test	p-value: 1.34E-10; Z-score: -1.14E+01
Methylation in Case	3.99E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	Body (cg03031182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 1.88E-06; Z-score: -6.58E+00
Methylation in Case	6.59E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	Body (cg07844507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 4.36E-06; Z-score: -5.09E+00
Methylation in Case	7.15E-01 (Median)	Methylation in Control	8.17E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC19A1 in bladder cancer			[ 2 ]
Location	Body (cg19074198)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 2.48E-05; Z-score: 4.92E+00
Methylation in Case	7.93E-01 (Median)	Methylation in Control	6.05E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	5'UTR (cg06731865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.03E-04; Z-score: -9.42E-01
Methylation in Case	8.03E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	5'UTR (cg03721454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 9.75E-04; Z-score: 1.12E+00
Methylation in Case	4.86E-01 (Median)	Methylation in Control	4.27E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	5'UTR (cg18035534)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 9.93E-03; Z-score: -6.78E-01
Methylation in Case	8.57E-01 (Median)	Methylation in Control	8.86E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	5'UTR (cg18353345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 2.20E-02; Z-score: -3.29E-01
Methylation in Case	7.76E-02 (Median)	Methylation in Control	8.25E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg07658590)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 1.35E-18; Z-score: 3.39E+00
Methylation in Case	5.86E-01 (Median)	Methylation in Control	4.14E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	TSS1500 (cg17243364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 2.85E-03; Z-score: -9.74E-01
Methylation in Case	1.62E-01 (Median)	Methylation in Control	1.84E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	TSS200 (cg18108695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 4.89E-02; Z-score: 2.49E-01
Methylation in Case	5.64E-02 (Median)	Methylation in Control	5.02E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	Body (cg27368243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 1.49E-03; Z-score: -1.42E+00
Methylation in Case	4.54E-01 (Median)	Methylation in Control	5.23E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	Body (cg07844507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.30E-02; Z-score: 3.08E-01
Methylation in Case	7.83E-01 (Median)	Methylation in Control	7.62E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	Body (cg04307902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.14E-02; Z-score: -6.75E-01
Methylation in Case	8.60E-01 (Median)	Methylation in Control	8.90E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC19A1 in breast cancer			[ 3 ]
Location	3'UTR (cg22991943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 9.53E-08; Z-score: -1.87E+00
Methylation in Case	6.31E-01 (Median)	Methylation in Control	7.21E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg18353345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -3.29E+00	Statistic Test	p-value: 8.06E-10; Z-score: -2.39E+00
Methylation in Case	6.73E-02 (Median)	Methylation in Control	2.21E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg03721454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 6.99E-07; Z-score: 3.19E+00
Methylation in Case	7.00E-01 (Median)	Methylation in Control	5.27E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in clear cell renal cell carcinoma			[ 4 ]
Location	5'UTR (cg06731865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.04E-06; Z-score: -2.54E+00
Methylation in Case	9.02E-01 (Median)	Methylation in Control	9.37E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg21279603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.81E-08; Z-score: -1.58E+00
Methylation in Case	8.23E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg27368243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.12E-06; Z-score: -1.51E+00
Methylation in Case	7.14E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg07844507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.90E-05; Z-score: -1.38E+00
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.56E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg03031182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 2.96E-03; Z-score: 2.74E+00
Methylation in Case	8.74E-01 (Median)	Methylation in Control	7.09E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg16071082)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.17E-02; Z-score: -4.74E-01
Methylation in Case	9.70E-01 (Median)	Methylation in Control	9.73E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in colon adenocarcinoma			[ 5 ]
Location	5'UTR (cg14393466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.75E-03; Z-score: -1.86E+00
Methylation in Case	6.84E-01 (Median)	Methylation in Control	7.55E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in colon adenocarcinoma			[ 5 ]
Location	TSS1500 (cg04592728)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.61E+00	Statistic Test	p-value: 1.34E-06; Z-score: 3.68E+00
Methylation in Case	5.61E-01 (Median)	Methylation in Control	3.48E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in colon adenocarcinoma			[ 5 ]
Location	TSS200 (cg03929977)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.24E+00	Statistic Test	p-value: 5.60E-08; Z-score: 3.88E+00
Methylation in Case	5.03E-01 (Median)	Methylation in Control	2.25E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in colon adenocarcinoma			[ 5 ]
Location	TSS200 (cg25811526)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 1.09E-06; Z-score: -3.93E+00
Methylation in Case	3.88E-01 (Median)	Methylation in Control	5.29E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in colon adenocarcinoma			[ 5 ]
Location	1stExon (cg05063104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 4.87E-04; Z-score: 1.98E+00
Methylation in Case	4.92E-01 (Median)	Methylation in Control	4.03E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in colon adenocarcinoma			[ 5 ]
Location	Body (cg12461092)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 2.68E-07; Z-score: -5.63E+00
Methylation in Case	4.57E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in colon adenocarcinoma			[ 5 ]
Location	Body (cg25822376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 1.36E-06; Z-score: -3.08E+00
Methylation in Case	5.36E-01 (Median)	Methylation in Control	7.08E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in colon adenocarcinoma			[ 5 ]
Location	Body (cg04470085)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.84E-05; Z-score: -5.56E+00
Methylation in Case	7.25E-01 (Median)	Methylation in Control	8.28E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	5'UTR (cg06731865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 5.12E-08; Z-score: -1.78E+00
Methylation in Case	8.95E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	5'UTR (cg15725933)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.59E-02; Z-score: 6.30E-01
Methylation in Case	3.78E-02 (Median)	Methylation in Control	3.31E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg17243364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 5.41E-07; Z-score: 1.62E+00
Methylation in Case	2.64E-01 (Median)	Methylation in Control	2.05E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg21279603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.16E-06; Z-score: -1.71E+00
Methylation in Case	8.48E-01 (Median)	Methylation in Control	8.94E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	TSS1500 (cg07658590)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.12E-03; Z-score: -1.01E+00
Methylation in Case	7.34E-01 (Median)	Methylation in Control	7.98E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg18108695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 1.32E-04; Z-score: 1.29E+00
Methylation in Case	3.75E-02 (Median)	Methylation in Control	2.81E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	TSS200 (cg10119313)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 3.80E-03; Z-score: 4.29E-01
Methylation in Case	2.58E-02 (Median)	Methylation in Control	2.30E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	Body (cg19074198)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 2.17E-05; Z-score: 1.42E+00
Methylation in Case	8.68E-01 (Median)	Methylation in Control	7.24E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	Body (cg07844507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.09E-04; Z-score: -9.80E-01
Methylation in Case	9.16E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	Body (cg27368243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.31E-02; Z-score: -4.99E-01
Methylation in Case	7.66E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	Body (cg04307902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 4.99E-02; Z-score: -1.63E-01
Methylation in Case	9.41E-01 (Median)	Methylation in Control	9.43E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC19A1 in colorectal cancer			[ 6 ]
Location	3'UTR (cg22991943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.05E-02; Z-score: -3.37E-01
Methylation in Case	9.11E-01 (Median)	Methylation in Control	9.15E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Hypermethylation of SLC19A1 in colorectal cancer			[ 18 ]
Location	Promoter
Epigenetic Type	Methylation	Experiment Method	Methylation-specific PCR
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Frequency	33 (78%) out of the 42 studied tumor samples
Experimental Material	Patient tissue samples
Additional Notes	SLC19A1 promoter Hypermethylation contribute to the occurrence and metastasis of CRC.
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in depression			[ 7 ]
Location	5'UTR (cg18353345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.60E-02; Z-score: -6.74E-01
Methylation in Case	7.15E-02 (Median)	Methylation in Control	7.68E-02 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	5'UTR (cg03721454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.30E-02; Z-score: -1.35E-01
Methylation in Case	6.99E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	TSS200 (cg02203420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.65E+00	Statistic Test	p-value: 3.96E-20; Z-score: -6.83E+00
Methylation in Case	4.66E-01 (Median)	Methylation in Control	7.70E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	TSS200 (cg22149516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.55E+00	Statistic Test	p-value: 6.67E-10; Z-score: 5.60E+00
Methylation in Case	2.76E-01 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg23462788)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.80E+00	Statistic Test	p-value: 1.99E-22; Z-score: -9.81E+00
Methylation in Case	4.52E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg02641517)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.85E+00	Statistic Test	p-value: 3.04E-17; Z-score: -4.02E+00
Methylation in Case	3.68E-01 (Median)	Methylation in Control	6.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg07806361)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 2.47E-14; Z-score: -4.85E+00
Methylation in Case	5.53E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg14310831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.28E+00	Statistic Test	p-value: 4.06E-11; Z-score: -1.72E+00
Methylation in Case	5.99E-01 (Median)	Methylation in Control	7.68E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg27368243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 8.89E-05; Z-score: 7.13E-01
Methylation in Case	5.38E-01 (Median)	Methylation in Control	4.75E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg03031182)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 5.16E-03; Z-score: -2.24E-01
Methylation in Case	8.53E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg17803589)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.37E-02; Z-score: 4.55E-01
Methylation in Case	8.12E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg07844507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.38E-02; Z-score: 4.87E-01
Methylation in Case	8.34E-01 (Median)	Methylation in Control	8.22E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC19A1 in hepatocellular carcinoma			[ 8 ]
Location	Body (cg00714531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 3.35E-02; Z-score: 2.10E-01
Methylation in Case	8.49E-01 (Median)	Methylation in Control	8.19E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
HIV infection	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in HIV infection			[ 9 ]
Location	5'UTR (cg06731865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 1.31E-10; Z-score: 3.30E+00
Methylation in Case	7.70E-01 (Median)	Methylation in Control	6.54E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in HIV infection			[ 9 ]
Location	TSS1500 (cg21279603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 4.62E-12; Z-score: 2.36E+00
Methylation in Case	7.31E-01 (Median)	Methylation in Control	6.26E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in HIV infection			[ 9 ]
Location	TSS1500 (cg07658590)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 2.73E-11; Z-score: 2.94E+00
Methylation in Case	6.06E-01 (Median)	Methylation in Control	4.49E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in HIV infection			[ 9 ]
Location	TSS1500 (cg17243364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 8.53E-07; Z-score: 1.50E+00
Methylation in Case	2.11E-01 (Median)	Methylation in Control	1.73E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in HIV infection			[ 9 ]
Location	Body (cg00714531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 4.00E-08; Z-score: 1.37E+00
Methylation in Case	9.07E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in HIV infection			[ 9 ]
Location	Body (cg07844507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 1.33E-07; Z-score: 1.62E+00
Methylation in Case	7.97E-01 (Median)	Methylation in Control	7.45E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in HIV infection			[ 9 ]
Location	Body (cg27368243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 1.95E-05; Z-score: 2.12E+00
Methylation in Case	3.77E-01 (Median)	Methylation in Control	2.92E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in HIV infection			[ 9 ]
Location	Body (cg19074198)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.43E-03; Z-score: 4.92E-01
Methylation in Case	8.74E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg18353345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 2.41E-03; Z-score: -1.50E+00
Methylation in Case	1.72E-01 (Median)	Methylation in Control	2.34E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in lung adenocarcinoma			[ 10 ]
Location	5'UTR (cg03721454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.32E-02; Z-score: 1.48E+00
Methylation in Case	7.55E-01 (Median)	Methylation in Control	6.37E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in lung adenocarcinoma			[ 10 ]
Location	TSS1500 (cg07658590)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 1.61E-03; Z-score: 4.09E+00
Methylation in Case	6.41E-01 (Median)	Methylation in Control	5.30E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg19074198)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 5.63E-03; Z-score: 2.00E+00
Methylation in Case	8.19E-01 (Median)	Methylation in Control	7.39E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg00714531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 3.31E-02; Z-score: 1.13E+00
Methylation in Case	9.06E-01 (Median)	Methylation in Control	8.75E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in lung adenocarcinoma			[ 10 ]
Location	Body (cg27368243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.55E-02; Z-score: -1.14E+00
Methylation in Case	5.94E-01 (Median)	Methylation in Control	6.36E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in panic disorder			[ 11 ]
Location	5'UTR (cg15725933)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.90E-01	Statistic Test	p-value: 4.80E-02; Z-score: -3.03E-01
Methylation in Case	-5.53E+00 (Median)	Methylation in Control	-5.47E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in panic disorder			[ 11 ]
Location	TSS1500 (cg07658590)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -8.04E-01	Statistic Test	p-value: 5.68E-03; Z-score: -5.32E-01
Methylation in Case	-9.11E-01 (Median)	Methylation in Control	-7.33E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	5'UTR (cg03721454)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.19E-07; Z-score: 1.64E+00
Methylation in Case	7.74E-01 (Median)	Methylation in Control	6.90E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	5'UTR (cg18353345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.31E+00	Statistic Test	p-value: 2.08E-05; Z-score: -9.67E-01
Methylation in Case	1.25E-01 (Median)	Methylation in Control	1.63E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	5'UTR (cg06731865)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 7.26E-03; Z-score: -6.25E-01
Methylation in Case	9.12E-01 (Median)	Methylation in Control	9.22E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	5'UTR (cg15725933)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.10E-02; Z-score: -5.95E-01
Methylation in Case	7.70E-02 (Median)	Methylation in Control	8.22E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg17243364)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 6.01E-06; Z-score: -8.12E-01
Methylation in Case	1.61E-01 (Median)	Methylation in Control	1.83E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	TSS1500 (cg21279603)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.15E-03; Z-score: -4.04E-01
Methylation in Case	8.04E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	Body (cg00714531)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 3.74E-06; Z-score: -1.06E+00
Methylation in Case	9.46E-01 (Median)	Methylation in Control	9.57E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	Body (cg25310447)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.14E-03; Z-score: -7.98E-01
Methylation in Case	9.34E-01 (Median)	Methylation in Control	9.41E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	Body (cg07996352)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 5.00E-03; Z-score: -4.16E-01
Methylation in Case	9.12E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	Body (cg27368243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.58E-02; Z-score: -2.47E-01
Methylation in Case	7.56E-01 (Median)	Methylation in Control	7.72E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	Body (cg07844507)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.60E-02; Z-score: -1.64E-01
Methylation in Case	8.98E-01 (Median)	Methylation in Control	9.01E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC19A1 in papillary thyroid cancer			[ 12 ]
Location	3'UTR (cg22991943)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.46E-02; Z-score: -6.77E-01
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	TSS1500 (cg06517489)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 8.14E-07; Z-score: 7.60E-02
Methylation in Case	1.19E-01 (Median)	Methylation in Control	1.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	TSS1500 (cg06746492)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.10E-04; Z-score: -3.24E-01
Methylation in Case	8.21E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	TSS1500 (cg04690729)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 2.44E-02; Z-score: -8.26E-03
Methylation in Case	7.89E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	1stExon (cg14930075)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 5.55E+00	Statistic Test	p-value: 5.14E-29; Z-score: 5.42E+00
Methylation in Case	4.37E-01 (Median)	Methylation in Control	7.88E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	1stExon (cg07726085)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 5.99E-05; Z-score: 1.31E+00
Methylation in Case	8.06E-01 (Median)	Methylation in Control	7.32E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	Body (cg23867721)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 3.67E-04; Z-score: 1.34E+00
Methylation in Case	6.51E-01 (Median)	Methylation in Control	5.94E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	Body (cg01554951)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 2.03E-03; Z-score: 8.53E-01
Methylation in Case	8.85E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	Body (cg21388745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.03E-03; Z-score: 9.69E-01
Methylation in Case	8.56E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	Body (cg14315842)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 7.03E-03; Z-score: 6.27E-01
Methylation in Case	8.26E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC19A1 in pancretic ductal adenocarcinoma			[ 13 ]
Location	3'UTR (cg06535968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 7.57E-03; Z-score: -3.58E-01
Methylation in Case	7.86E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Celiac disease	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in celiac disease			[ 14 ]
Location	Body (cg19074198)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 3.82E-03; Z-score: 1.09E+00
Methylation in Case	8.21E-01 (Median)	Methylation in Control	6.35E-01 (Median)
Studied Phenotype	Celiac disease [ ICD-11: DA95]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC19A1 in celiac disease			[ 14 ]
Location	Body (cg27368243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 4.74E-03; Z-score: -1.24E+00
Methylation in Case	4.74E-01 (Median)	Methylation in Control	6.94E-01 (Median)
Studied Phenotype	Celiac disease [ ICD-11: DA95]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in prostate cancer			[ 15 ]
Location	Body (cg26961166)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.79E+00	Statistic Test	p-value: 5.02E-03; Z-score: -1.67E+01
Methylation in Case	2.57E-01 (Median)	Methylation in Control	4.59E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC19A1 in systemic lupus erythematosus			[ 16 ]
Location	Body (cg07996352)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 4.71E-02; Z-score: -2.27E-01
Methylation in Case	9.06E-01 (Median)	Methylation in Control	9.10E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
microRNA
B-cell acute lymphoblastic leukemia	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-595 downregulates SLC19A1 in B-cell acute lymphoblastic leukemia			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
Related Molecular Changes	Down regulation of SLC19A1	Experiment Method	Microarrays
miRNA Stemloop ID	miR-595	miRNA Mature ID	miR-595
miRNA Sequence	GAAGUGUGCCGUGGUGUGUCU
miRNA Target Type	Direct
Studied Phenotype	B-cell acute lymphoblastic leukemia [ ICD-11: 2A82]
Experimental Material	Patient tissue samples
Additional Notes	SNPs in miR-595 that might affect SLC19A1 MTX transport gene regulation and could affect MTX levels in patients with pediatric B-cell ALL.
Unclear Phenotype	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-125b directly targets SLC19A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-125b	miRNA Mature ID	miR-125b-5p
miRNA Sequence	UCCCUGAGACCCUAACUUGUGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 2	miR-16 directly targets SLC19A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-16	miRNA Mature ID	miR-16-5p
miRNA Sequence	UAGCAGCACGUAAAUAUUGGCG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	miR-3613 directly targets SLC19A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3613	miRNA Mature ID	miR-3613-3p
miRNA Sequence	ACAAAAAAAAAAGCCCAACCCUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-4422 directly targets SLC19A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4422	miRNA Mature ID	miR-4422
miRNA Sequence	AAAAGCAUCAGGAAGUACCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-4668 directly targets SLC19A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4668	miRNA Mature ID	miR-4668-5p
miRNA Sequence	AGGGAAAAAAAAAAGGAUUUGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-484 directly targets SLC19A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-484	miRNA Mature ID	miR-484
miRNA Sequence	UCAGGCUCAGUCCCCUCCCGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 7	miR-548e directly targets SLC19A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548e	miRNA Mature ID	miR-548e-5p
miRNA Sequence	CAAAAGCAAUCGCGGUUUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-607 directly targets SLC19A1			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-607	miRNA Mature ID	miR-607
miRNA Sequence	GUUCAAAUCCAGAUCUAUAAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-93 directly targets SLC19A1			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-93	miRNA Mature ID	miR-93-5p
miRNA Sequence	CAAAGUGCUGUUCGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)

References
1	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
8	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
9	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
12	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
14	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
15	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
17	MiR-pharmacogenetics of methotrexate in childhood B-cell acute lymphoblastic leukemia. Pharmacogenet Genomics. 2016 Nov;26(11):517-525.
18	Hypermethylation of protocadherin subfamily A12 and solute carrier family 19 A 1 promoters contributes to the occurrence and metastasis of colorectal cancer. Oncol Lett. 2018 Jun;15(6):8215-8222.
19	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
20	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence