Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0129 Transporter Info
Gene Name	SLC1A1
Transporter Name	Excitatory amino acid transporter 3
Gene ID	6505
UniProt ID	P43005

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg18703983)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 1.55E-03; Z-score: -2.76E+00
Methylation in Case	5.83E-01 (Median)	Methylation in Control	6.93E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in colon adenocarcinoma			[ 1 ]
Location	TSS1500 (cg25493658)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 4.53E-03; Z-score: -1.89E+00
Methylation in Case	6.98E-01 (Median)	Methylation in Control	7.52E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC1A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg15531450)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 1.01E-05; Z-score: -3.37E+00
Methylation in Case	4.66E-01 (Median)	Methylation in Control	5.64E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC1A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg10420578)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.18E-05; Z-score: -3.92E+00
Methylation in Case	7.89E-01 (Median)	Methylation in Control	8.83E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC1A1 in colon adenocarcinoma			[ 1 ]
Location	Body (cg06046344)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 1.12E-03; Z-score: -1.67E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC1A1 in colon adenocarcinoma			[ 1 ]
Location	3'UTR (cg06535968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 4.48E-05; Z-score: -2.84E+00
Methylation in Case	6.56E-01 (Median)	Methylation in Control	7.76E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Prostate cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in prostate cancer			[ 2 ]
Location	5'UTR (cg18047353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 1.47E-02; Z-score: -2.91E+00
Methylation in Case	1.62E-01 (Median)	Methylation in Control	2.55E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in prostate cancer			[ 2 ]
Location	Body (cg16726201)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.97E+00	Statistic Test	p-value: 3.89E-04; Z-score: 7.66E+00
Methylation in Case	6.74E-01 (Median)	Methylation in Control	2.27E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in hepatocellular carcinoma			[ 3 ]
Location	TSS1500 (cg14452299)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.46E+00	Statistic Test	p-value: 8.93E-16; Z-score: -7.10E+00
Methylation in Case	4.93E-01 (Median)	Methylation in Control	7.18E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in hepatocellular carcinoma			[ 3 ]
Location	TSS200 (cg24611631)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 2.51E-02; Z-score: -3.09E-01
Methylation in Case	6.31E-02 (Median)	Methylation in Control	6.82E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC1A1 in hepatocellular carcinoma			[ 3 ]
Location	1stExon (cg13555101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 9.36E-07; Z-score: -7.68E-01
Methylation in Case	7.49E-02 (Median)	Methylation in Control	8.33E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC1A1 in hepatocellular carcinoma			[ 3 ]
Location	1stExon (cg04711050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 6.27E-03; Z-score: -5.55E-01
Methylation in Case	6.54E-02 (Median)	Methylation in Control	7.10E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC1A1 in hepatocellular carcinoma			[ 3 ]
Location	Body (cg13802605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 7.64E-04; Z-score: -2.92E-01
Methylation in Case	7.78E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC1A1 in hepatocellular carcinoma			[ 3 ]
Location	Body (cg21156276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 8.80E-04; Z-score: 1.16E+00
Methylation in Case	6.03E-01 (Median)	Methylation in Control	5.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS1500 (cg00315391)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 4.47E-07; Z-score: 3.82E-01
Methylation in Case	9.48E-02 (Median)	Methylation in Control	8.68E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in pancretic ductal adenocarcinoma			[ 4 ]
Location	TSS1500 (cg17415721)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 2.77E-04; Z-score: -6.32E-01
Methylation in Case	7.27E-02 (Median)	Methylation in Control	8.14E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC1A1 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg16854533)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+00	Statistic Test	p-value: 5.97E-36; Z-score: -5.73E+00
Methylation in Case	5.18E-01 (Median)	Methylation in Control	8.01E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC1A1 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg13406085)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.45E-05; Z-score: -6.37E-01
Methylation in Case	6.92E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC1A1 in pancretic ductal adenocarcinoma			[ 4 ]
Location	Body (cg00767977)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 2.22E-02; Z-score: 9.29E-01
Methylation in Case	7.74E-01 (Median)	Methylation in Control	7.47E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Bladder cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in bladder cancer			[ 5 ]
Location	TSS200 (cg24611631)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 7.03E-04; Z-score: -2.19E+00
Methylation in Case	6.23E-02 (Median)	Methylation in Control	7.30E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in bladder cancer			[ 5 ]
Location	1stExon (cg04711050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 7.59E-03; Z-score: -1.34E+00
Methylation in Case	6.65E-02 (Median)	Methylation in Control	7.53E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC1A1 in bladder cancer			[ 5 ]
Location	1stExon (cg13555101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 3.70E-02; Z-score: -1.54E+00
Methylation in Case	8.11E-02 (Median)	Methylation in Control	9.08E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC1A1 in bladder cancer			[ 5 ]
Location	Body (cg13599596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 5.21E-07; Z-score: -9.95E+00
Methylation in Case	7.26E-01 (Median)	Methylation in Control	8.85E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC1A1 in bladder cancer			[ 5 ]
Location	Body (cg21156276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 1.77E-06; Z-score: -4.46E+00
Methylation in Case	4.29E-01 (Median)	Methylation in Control	5.88E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC1A1 in bladder cancer			[ 5 ]
Location	Body (cg13802605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 2.03E-05; Z-score: -4.50E+00
Methylation in Case	7.39E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC1A1 in bladder cancer			[ 5 ]
Location	Body (cg14276488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.29E+00	Statistic Test	p-value: 1.20E-03; Z-score: -3.90E+00
Methylation in Case	3.54E-02 (Median)	Methylation in Control	4.56E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Renal cell carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg24611631)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 1.58E-05; Z-score: 1.05E+00
Methylation in Case	3.15E-02 (Median)	Methylation in Control	2.39E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in clear cell renal cell carcinoma			[ 6 ]
Location	TSS200 (cg14583606)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.90E-05; Z-score: 5.57E-01
Methylation in Case	1.53E-02 (Median)	Methylation in Control	1.46E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC1A1 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg04711050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 3.14E-02; Z-score: 7.58E-01
Methylation in Case	3.06E-02 (Median)	Methylation in Control	2.48E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC1A1 in clear cell renal cell carcinoma			[ 6 ]
Location	1stExon (cg13555101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 3.95E-02; Z-score: 5.07E-01
Methylation in Case	4.31E-02 (Median)	Methylation in Control	3.82E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC1A1 in clear cell renal cell carcinoma			[ 6 ]
Location	Body (cg14276488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 1.58E-04; Z-score: 6.29E-01
Methylation in Case	2.58E-02 (Median)	Methylation in Control	2.28E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC1A1 in clear cell renal cell carcinoma			[ 6 ]
Location	Body (cg21156276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 7.23E-03; Z-score: -1.30E+00
Methylation in Case	5.72E-01 (Median)	Methylation in Control	6.36E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC1A1 in clear cell renal cell carcinoma			[ 6 ]
Location	Body (cg07196069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 9.99E-03; Z-score: 6.39E-01
Methylation in Case	8.73E-02 (Median)	Methylation in Control	7.22E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in colorectal cancer			[ 7 ]
Location	TSS200 (cg24611631)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.37E-02; Z-score: 9.33E-01
Methylation in Case	1.01E-01 (Median)	Methylation in Control	8.45E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in colorectal cancer			[ 7 ]
Location	1stExon (cg04711050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 4.35E-02; Z-score: 8.31E-01
Methylation in Case	9.58E-02 (Median)	Methylation in Control	8.70E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC1A1 in colorectal cancer			[ 7 ]
Location	Body (cg13802605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 8.58E-08; Z-score: -1.93E+00
Methylation in Case	8.66E-01 (Median)	Methylation in Control	9.13E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC1A1 in colorectal cancer			[ 7 ]
Location	Body (cg13599596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 7.37E-05; Z-score: 1.44E+00
Methylation in Case	8.98E-01 (Median)	Methylation in Control	7.79E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
HIV infection	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in HIV infection			[ 8 ]
Location	TSS200 (cg24611631)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 1.67E-02; Z-score: 6.96E-01
Methylation in Case	8.52E-02 (Median)	Methylation in Control	7.49E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in HIV infection			[ 8 ]
Location	TSS200 (cg14583606)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.37E+00	Statistic Test	p-value: 2.75E-02; Z-score: 7.36E-01
Methylation in Case	1.38E-02 (Median)	Methylation in Control	1.01E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC1A1 in HIV infection			[ 8 ]
Location	1stExon (cg13555101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 4.24E-03; Z-score: 8.89E-01
Methylation in Case	9.67E-02 (Median)	Methylation in Control	8.04E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC1A1 in HIV infection			[ 8 ]
Location	1stExon (cg04711050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.02E-02; Z-score: 5.23E-01
Methylation in Case	7.85E-02 (Median)	Methylation in Control	6.78E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC1A1 in HIV infection			[ 8 ]
Location	Body (cg14276488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 1.06E-03; Z-score: 7.33E-01
Methylation in Case	4.85E-02 (Median)	Methylation in Control	3.73E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC1A1 in HIV infection			[ 8 ]
Location	Body (cg07196069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 5.79E-03; Z-score: 6.73E-01
Methylation in Case	1.70E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC1A1 in HIV infection			[ 8 ]
Location	Body (cg13802605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.61E-02; Z-score: -6.06E-01
Methylation in Case	8.28E-01 (Median)	Methylation in Control	8.43E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in systemic lupus erythematosus			[ 9 ]
Location	TSS200 (cg24611631)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 3.38E-02; Z-score: 2.34E-02
Methylation in Case	1.02E-01 (Median)	Methylation in Control	1.01E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	1stExon (cg04711050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.70E+00	Statistic Test	p-value: 3.10E-24; Z-score: -3.72E+00
Methylation in Case	4.53E-01 (Median)	Methylation in Control	7.69E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	1stExon (cg13555101)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.38E+00	Statistic Test	p-value: 2.36E-19; Z-score: -2.92E+00
Methylation in Case	2.71E-01 (Median)	Methylation in Control	6.46E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC1A1 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg07196069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 3.51E-03; Z-score: -6.29E-01
Methylation in Case	3.93E-01 (Median)	Methylation in Control	4.60E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC1A1 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg13599596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 3.74E-02; Z-score: -5.51E-01
Methylation in Case	8.22E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC1A1 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg13802605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.90E-02; Z-score: 2.04E-01
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.62E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC1A1 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg14276488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.40E-02; Z-score: -6.53E-01
Methylation in Case	7.76E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Breast cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in breast cancer			[ 11 ]
Location	1stExon (cg04711050)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 4.57E-02; Z-score: 3.96E-01
Methylation in Case	6.93E-02 (Median)	Methylation in Control	6.23E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC1A1 in breast cancer			[ 11 ]
Location	Body (cg13802605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.84E-12; Z-score: -2.34E+00
Methylation in Case	7.53E-01 (Median)	Methylation in Control	8.25E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC1A1 in breast cancer			[ 11 ]
Location	Body (cg21156276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 6.91E-08; Z-score: -1.70E+00
Methylation in Case	5.78E-01 (Median)	Methylation in Control	6.86E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC1A1 in breast cancer			[ 11 ]
Location	Body (cg13599596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 7.98E-05; Z-score: -8.35E-01
Methylation in Case	8.51E-01 (Median)	Methylation in Control	8.95E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC1A1 in breast cancer			[ 11 ]
Location	Body (cg07196069)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 7.11E-04; Z-score: 6.62E-01
Methylation in Case	1.38E-01 (Median)	Methylation in Control	1.18E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC1A1 in breast cancer			[ 11 ]
Location	Body (cg14276488)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.45E-03; Z-score: 3.04E-01
Methylation in Case	4.25E-02 (Median)	Methylation in Control	3.81E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in lung adenocarcinoma			[ 12 ]
Location	Body (cg13802605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 8.47E-03; Z-score: -3.29E+00
Methylation in Case	8.03E-01 (Median)	Methylation in Control	8.52E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC1A1 in panic disorder			[ 13 ]
Location	Body (cg13802605)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.38E-02; Z-score: 3.03E-01
Methylation in Case	2.71E+00 (Median)	Methylation in Control	2.56E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
microRNA
Multiple system atrophy	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Higher expression of miR-124 in multiple system atrophy			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	Luciferase reporter assay
Related Molecular Changes	Down regulation of SLC1A1	Experiment Method	Immunohistochemical staining
miRNA Stemloop ID	miR-96	miRNA Mature ID	Unclear
miRNA Target Type	Direct
Studied Phenotype	Multiple system atrophy [ ICD-11: 8D87.0]
Experimental Material	Patient tissue samples
Additional Notes	miR-96 downregulates SLC1A1 in multiple system atrophy, and its dysregulation may play a role in MSA.
Unclear Phenotype	33 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1237 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1237	miRNA Mature ID	miR-1237-3p
miRNA Sequence	UCCUUCUGCUCCGUCCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-1248 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1248	miRNA Mature ID	miR-1248
miRNA Sequence	ACCUUCUUGUAUAAGCACUGUGCUAAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-1255a directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1255a	miRNA Mature ID	miR-1255a
miRNA Sequence	AGGAUGAGCAAAGAAAGUAGAUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-1255b directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1255b	miRNA Mature ID	miR-1255b-5p
miRNA Sequence	CGGAUGAGCAAAGAAAGUGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-186 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-5p
miRNA Sequence	CAAAGAAUUCUCCUUUUGGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-204 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-204	miRNA Mature ID	miR-204-5p
miRNA Sequence	UUCCCUUUGUCAUCCUAUGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-211 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-211	miRNA Mature ID	miR-211-5p
miRNA Sequence	UUCCCUUUGUCAUCCUUCGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-2113 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2113	miRNA Mature ID	miR-2113
miRNA Sequence	AUUUGUGCUUGGCUCUGUCAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-335 directly targets SLC1A1			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	Microarray
miRNA Stemloop ID	miR-335	miRNA Mature ID	miR-335-5p
miRNA Sequence	UCAAGAGCAAUAACGAAAAAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-4287 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4287	miRNA Mature ID	miR-4287
miRNA Sequence	UCUCCCUUGAGGGCACUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-4469 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4469	miRNA Mature ID	miR-4469
miRNA Sequence	GCUCCCUCUAGGGUCGCUCGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-4641 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4641	miRNA Mature ID	miR-4641
miRNA Sequence	UGCCCAUGCCAUACUUUUGCCUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-4659a directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4659a	miRNA Mature ID	miR-4659a-3p
miRNA Sequence	UUUCUUCUUAGACAUGGCAACG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-4659b directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4659b	miRNA Mature ID	miR-4659b-3p
miRNA Sequence	UUUCUUCUUAGACAUGGCAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-4685 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4685	miRNA Mature ID	miR-4685-3p
miRNA Sequence	UCUCCCUUCCUGCCCUGGCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-4713 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4713	miRNA Mature ID	miR-4713-5p
miRNA Sequence	UUCUCCCACUACCAGGCUCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-500a directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-500a	miRNA Mature ID	miR-500a-5p
miRNA Sequence	UAAUCCUUGCUACCUGGGUGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-5010 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5010	miRNA Mature ID	miR-5010-3p
miRNA Sequence	UUUUGUGUCUCCCAUUCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-5586 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5586	miRNA Mature ID	miR-5586-5p
miRNA Sequence	UAUCCAGCUUGUUACUAUAUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-629 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-629	miRNA Mature ID	miR-629-3p
miRNA Sequence	GUUCUCCCAACGUAAGCCCAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-6512 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6512	miRNA Mature ID	miR-6512-3p
miRNA Sequence	UUCCAGCCCUUCUAAUGGUAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-652 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-652	miRNA Mature ID	miR-652-5p
miRNA Sequence	CAACCCUAGGAGAGGGUGCCAUUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-6720 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6720	miRNA Mature ID	miR-6720-5p
miRNA Sequence	UUCCAGCCCUGGUAGGCGCCGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-6744 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6744	miRNA Mature ID	miR-6744-5p
miRNA Sequence	UGGAUGACAGUGGAGGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-6832 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6832	miRNA Mature ID	miR-6832-3p
miRNA Sequence	ACCCUUUUUCUCUUUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-6835 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6835	miRNA Mature ID	miR-6835-3p
miRNA Sequence	AAAAGCACUUUUCUGUCUCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-6849 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6849	miRNA Mature ID	miR-6849-3p
miRNA Sequence	ACCAGCCUGUGUCCACCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-6867 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6867	miRNA Mature ID	miR-6867-3p
miRNA Sequence	CUCUCCCUCUUUACCCACUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-6868 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6868	miRNA Mature ID	miR-6868-3p
miRNA Sequence	UUCCUUCUGUUGUCUGUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-6875 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6875	miRNA Mature ID	miR-6875-3p
miRNA Sequence	AUUCUUCCUGCCCUGGCUCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-7113 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7113	miRNA Mature ID	miR-7113-3p
miRNA Sequence	CCUCCCUGCCCGCCUCUCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-758 directly targets SLC1A1			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-758	miRNA Mature ID	miR-758-3p
miRNA Sequence	UUUGUGACCUGGUCCACUAACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-96 directly targets SLC1A1			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	Immunohistochemistry//Luciferase reporter assay//qRT-PCR
miRNA Stemloop ID	miR-96	miRNA Mature ID	miR-96-5p
miRNA Sequence	UUUGGCACUAGCACAUUUUUGCU
miRNA Target Type	Direct
Experimental Material	Patient tissue samples

References
1	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
3	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
5	DNA Methylation Dynamics in Urological Tumors.
6	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
8	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11	Genome-wide Scan for Methylation Profiles in Breast Cancer
12	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14	Widespread microRNA dysregulation in multiple system atrophy - disease-related alteration in miR-96. Eur J Neurosci. 2014 Mar;39(6):1026-41.
15	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16	Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence