Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0130 Transporter Info | ||||
| Gene Name | SLC1A2 | ||||
| Transporter Name | Excitatory amino acid transporter 2 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Pancretic ductal adenocarcinoma |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg06482428) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.90E+00 | Statistic Test | p-value: 8.23E-22; Z-score: 3.45E+00 | ||
|
Methylation in Case |
4.55E-01 (Median) | Methylation in Control | 2.40E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg10844844) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 7.99E-04; Z-score: -5.52E-01 | ||
|
Methylation in Case |
1.35E-01 (Median) | Methylation in Control | 1.55E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg02196227) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 9.64E-03; Z-score: 8.67E-01 | ||
|
Methylation in Case |
8.32E-02 (Median) | Methylation in Control | 6.89E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg18440902) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.91E+00 | Statistic Test | p-value: 2.33E-21; Z-score: 5.47E+00 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 7.93E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg20786061) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 7.83E-04; Z-score: -7.54E-01 | ||
|
Methylation in Case |
6.04E-02 (Median) | Methylation in Control | 6.52E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg19556774) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 1.65E-02; Z-score: 1.44E-01 | ||
|
Methylation in Case |
4.27E-01 (Median) | Methylation in Control | 4.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
1stExon (cg15668691) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.48E-05; Z-score: 8.20E-01 | ||
|
Methylation in Case |
8.74E-01 (Median) | Methylation in Control | 8.33E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19521693) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 1.04E-20; Z-score: -3.09E+00 | ||
|
Methylation in Case |
3.06E-01 (Median) | Methylation in Control | 4.10E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg04994795) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 9.39E-16; Z-score: -2.26E+00 | ||
|
Methylation in Case |
4.59E-01 (Median) | Methylation in Control | 6.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg24712501) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 7.18E-08; Z-score: -1.13E+00 | ||
|
Methylation in Case |
4.30E-01 (Median) | Methylation in Control | 4.80E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg11624345) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 7.05E-07; Z-score: 1.66E+00 | ||
|
Methylation in Case |
5.50E-01 (Median) | Methylation in Control | 4.11E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg10238725) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 6.42E-06; Z-score: -9.19E-01 | ||
|
Methylation in Case |
7.27E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg23093692) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.67E-03; Z-score: -1.02E+00 | ||
|
Methylation in Case |
6.86E-01 (Median) | Methylation in Control | 7.76E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg19538722) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 6.07E-03; Z-score: -3.84E-01 | ||
|
Methylation in Case |
9.69E-02 (Median) | Methylation in Control | 1.06E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg23529278) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.71E-02; Z-score: 8.86E-01 | ||
|
Methylation in Case |
9.01E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A2 in pancretic ductal adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg15310871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.64E-05; Z-score: -9.83E-01 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 8.61E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
23 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg25963980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.77E+00 | Statistic Test | p-value: 3.15E-08; Z-score: -1.69E+01 | ||
|
Methylation in Case |
3.03E-01 (Median) | Methylation in Control | 5.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg08258650) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.69E+00 | Statistic Test | p-value: 2.24E-06; Z-score: -6.44E+00 | ||
|
Methylation in Case |
8.33E-02 (Median) | Methylation in Control | 3.08E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg10159951) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.24E+00 | Statistic Test | p-value: 1.31E-04; Z-score: -4.33E+00 | ||
|
Methylation in Case |
1.09E-01 (Median) | Methylation in Control | 3.52E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg21163960) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -4.14E+00 | Statistic Test | p-value: 3.08E-03; Z-score: -2.54E+00 | ||
|
Methylation in Case |
6.42E-02 (Median) | Methylation in Control | 2.66E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg15562780) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 8.28E-03; Z-score: 2.40E+00 | ||
|
Methylation in Case |
1.13E-01 (Median) | Methylation in Control | 1.01E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS1500 (cg24634422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.02E+00 | Statistic Test | p-value: 2.33E-02; Z-score: -2.14E+00 | ||
|
Methylation in Case |
7.48E-02 (Median) | Methylation in Control | 1.51E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
TSS200 (cg07724977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.07E+00 | Statistic Test | p-value: 2.77E-03; Z-score: 1.70E+00 | ||
|
Methylation in Case |
4.91E-02 (Median) | Methylation in Control | 2.37E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg21895324) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.70E+00 | Statistic Test | p-value: 1.19E-11; Z-score: -1.02E+01 | ||
|
Methylation in Case |
2.26E-01 (Median) | Methylation in Control | 6.11E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg19653967) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 8.91E-08; Z-score: -5.54E+00 | ||
|
Methylation in Case |
3.62E-01 (Median) | Methylation in Control | 5.78E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg10331829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.33E+00 | Statistic Test | p-value: 2.74E-07; Z-score: -6.12E+00 | ||
|
Methylation in Case |
2.69E-01 (Median) | Methylation in Control | 6.26E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg13844463) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.61E+00 | Statistic Test | p-value: 9.23E-07; Z-score: -7.23E+00 | ||
|
Methylation in Case |
1.48E-01 (Median) | Methylation in Control | 5.34E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg14746605) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 9.19E-05; Z-score: -4.27E+00 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg27457284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.00E+00 | Statistic Test | p-value: 5.01E-04; Z-score: -2.92E+00 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 3.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg13971030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.63E+00 | Statistic Test | p-value: 1.31E-03; Z-score: 3.53E+00 | ||
|
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 5.07E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg19112204) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.47E+00 | Statistic Test | p-value: 1.69E-03; Z-score: -3.12E+00 | ||
|
Methylation in Case |
5.23E-01 (Median) | Methylation in Control | 7.69E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 4.53E-03; Z-score: 2.24E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 6.14E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg22934516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 5.39E-03; Z-score: 1.72E+00 | ||
|
Methylation in Case |
7.52E-02 (Median) | Methylation in Control | 5.77E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg24944109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.64E+00 | Statistic Test | p-value: 6.40E-03; Z-score: -1.80E+00 | ||
|
Methylation in Case |
1.44E-01 (Median) | Methylation in Control | 2.37E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg23501962) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.32E+00 | Statistic Test | p-value: 1.16E-02; Z-score: -1.28E+00 | ||
|
Methylation in Case |
1.93E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg24183324) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.14E+00 | Statistic Test | p-value: 1.20E-02; Z-score: -1.55E+00 | ||
|
Methylation in Case |
1.06E-01 (Median) | Methylation in Control | 2.27E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg25961618) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.24E-02; Z-score: -1.94E+00 | ||
|
Methylation in Case |
7.66E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
Body (cg08411235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.81E-02; Z-score: -1.81E+00 | ||
|
Methylation in Case |
2.66E-01 (Median) | Methylation in Control | 3.33E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC1A2 in bladder cancer | [ 2 ] | |||
|
Location |
3'UTR (cg26635576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 7.08E-03; Z-score: -2.33E+00 | ||
|
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
21 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg25963980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 3.10E-08; Z-score: -1.79E+00 | ||
|
Methylation in Case |
4.51E-01 (Median) | Methylation in Control | 6.12E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg24634422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.37E+00 | Statistic Test | p-value: 4.88E-07; Z-score: 9.35E-01 | ||
|
Methylation in Case |
6.12E-02 (Median) | Methylation in Control | 4.45E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg10159951) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 9.64E-05; Z-score: 6.80E-01 | ||
|
Methylation in Case |
1.54E-01 (Median) | Methylation in Control | 1.20E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg21163960) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.95E+00 | Statistic Test | p-value: 2.77E-04; Z-score: 1.29E+00 | ||
|
Methylation in Case |
1.39E-01 (Median) | Methylation in Control | 7.16E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg18494399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 4.69E-04; Z-score: 3.04E-01 | ||
|
Methylation in Case |
2.23E-02 (Median) | Methylation in Control | 1.58E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg08258650) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 4.30E-03; Z-score: 5.30E-02 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 1.15E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg15562780) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.79E-02; Z-score: 3.24E-02 | ||
|
Methylation in Case |
8.77E-02 (Median) | Methylation in Control | 8.69E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg07724977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.80E+00 | Statistic Test | p-value: 1.76E-07; Z-score: -1.05E+00 | ||
|
Methylation in Case |
1.64E-02 (Median) | Methylation in Control | 4.60E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg17754876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.20E-02; Z-score: -3.15E-01 | ||
|
Methylation in Case |
1.11E-01 (Median) | Methylation in Control | 1.19E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
TSS200 (cg25230151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 2.59E-02; Z-score: -3.21E-01 | ||
|
Methylation in Case |
1.48E-02 (Median) | Methylation in Control | 1.81E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg23501962) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.70E+00 | Statistic Test | p-value: 5.09E-17; Z-score: -2.35E+00 | ||
|
Methylation in Case |
1.71E-01 (Median) | Methylation in Control | 2.90E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg24183324) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.95E+00 | Statistic Test | p-value: 1.14E-15; Z-score: -2.22E+00 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 2.52E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg19112204) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 2.69E-15; Z-score: -2.77E+00 | ||
|
Methylation in Case |
4.97E-01 (Median) | Methylation in Control | 6.64E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg24944109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.82E+00 | Statistic Test | p-value: 2.16E-11; Z-score: -1.49E+00 | ||
|
Methylation in Case |
1.09E-01 (Median) | Methylation in Control | 1.98E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 1.92E-07; Z-score: 1.64E+00 | ||
|
Methylation in Case |
5.77E-01 (Median) | Methylation in Control | 4.54E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg27457284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.13E+00 | Statistic Test | p-value: 2.10E-07; Z-score: -1.40E+00 | ||
|
Methylation in Case |
1.32E-01 (Median) | Methylation in Control | 2.82E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg14746605) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.48E-05; Z-score: -6.74E-01 | ||
|
Methylation in Case |
8.71E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg19653967) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 6.46E-04; Z-score: -7.90E-01 | ||
|
Methylation in Case |
4.80E-01 (Median) | Methylation in Control | 5.26E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg13844463) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 4.43E-03; Z-score: -1.04E+00 | ||
|
Methylation in Case |
3.36E-01 (Median) | Methylation in Control | 3.95E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
Body (cg20740024) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.89E-02; Z-score: 2.89E-01 | ||
|
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC1A2 in breast cancer | [ 3 ] | |||
|
Location |
3'UTR (cg25475999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.94E-02; Z-score: -3.71E-01 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg18494399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.47E+00 | Statistic Test | p-value: 1.38E-04; Z-score: 1.91E+00 | ||
|
Methylation in Case |
2.45E-02 (Median) | Methylation in Control | 1.67E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg10159951) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.03E+00 | Statistic Test | p-value: 5.23E-04; Z-score: 2.48E+00 | ||
|
Methylation in Case |
5.19E-02 (Median) | Methylation in Control | 2.56E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg24634422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.94E+00 | Statistic Test | p-value: 7.81E-04; Z-score: 1.11E+00 | ||
|
Methylation in Case |
2.44E-02 (Median) | Methylation in Control | 1.26E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg08258650) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.56E+00 | Statistic Test | p-value: 1.19E-03; Z-score: 1.27E+00 | ||
|
Methylation in Case |
3.22E-02 (Median) | Methylation in Control | 2.07E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS1500 (cg21163960) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.40E-02; Z-score: 1.00E+00 | ||
|
Methylation in Case |
4.02E-02 (Median) | Methylation in Control | 3.59E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg17754876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.42E+00 | Statistic Test | p-value: 6.98E-04; Z-score: 1.67E+00 | ||
|
Methylation in Case |
8.07E-02 (Median) | Methylation in Control | 5.70E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg25230151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.52E-02; Z-score: 7.89E-01 | ||
|
Methylation in Case |
1.47E-02 (Median) | Methylation in Control | 1.31E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg07724977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.20E+00 | Statistic Test | p-value: 3.16E-02; Z-score: 4.05E-01 | ||
|
Methylation in Case |
2.69E-02 (Median) | Methylation in Control | 2.25E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg23501962) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.93E+00 | Statistic Test | p-value: 1.16E-06; Z-score: 1.67E+00 | ||
|
Methylation in Case |
2.21E-01 (Median) | Methylation in Control | 1.15E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg24944109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.70E+00 | Statistic Test | p-value: 1.82E-05; Z-score: 1.45E+00 | ||
|
Methylation in Case |
1.46E-01 (Median) | Methylation in Control | 8.58E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg24183324) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.70E+00 | Statistic Test | p-value: 2.53E-05; Z-score: 1.24E+00 | ||
|
Methylation in Case |
1.31E-01 (Median) | Methylation in Control | 7.74E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A2 in clear cell renal cell carcinoma | [ 4 ] | |||
|
Location |
Body (cg27457284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.55E+00 | Statistic Test | p-value: 3.22E-05; Z-score: 1.56E+00 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 1.55E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg07744841) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.49E+00 | Statistic Test | p-value: 1.41E-06; Z-score: 2.21E+00 | ||
|
Methylation in Case |
6.01E-01 (Median) | Methylation in Control | 4.04E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg25468058) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 1.15E-05; Z-score: -6.18E+00 | ||
|
Methylation in Case |
7.32E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg09360041) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 1.66E-05; Z-score: -3.40E+00 | ||
|
Methylation in Case |
6.34E-01 (Median) | Methylation in Control | 7.85E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg17445913) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.88E+00 | Statistic Test | p-value: 1.55E-04; Z-score: 4.19E+00 | ||
|
Methylation in Case |
3.67E-01 (Median) | Methylation in Control | 1.95E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg15932136) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 3.49E-03; Z-score: -2.12E+00 | ||
|
Methylation in Case |
3.56E-01 (Median) | Methylation in Control | 4.28E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
TSS1500 (cg18646365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 4.55E-03; Z-score: 1.55E+00 | ||
|
Methylation in Case |
5.46E-01 (Median) | Methylation in Control | 4.38E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
TSS200 (cg08288703) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 1.35E-05; Z-score: -1.77E+00 | ||
|
Methylation in Case |
3.45E-01 (Median) | Methylation in Control | 4.31E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
1stExon (cg15726426) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 1.48E-04; Z-score: 1.19E+00 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 5.27E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
Body (cg23947050) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 3.99E-05; Z-score: -4.04E+00 | ||
|
Methylation in Case |
6.29E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
Body (cg05701706) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.19E-04; Z-score: 1.28E+00 | ||
|
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.24E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
Body (cg10156714) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.21E-04; Z-score: -2.21E+00 | ||
|
Methylation in Case |
7.38E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A2 in colon adenocarcinoma | [ 5 ] | |||
|
Location |
Body (cg00551954) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.55E-03; Z-score: 1.06E+00 | ||
|
Methylation in Case |
8.35E-01 (Median) | Methylation in Control | 8.12E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
21 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg24634422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 3.13E+00 | Statistic Test | p-value: 2.57E-11; Z-score: 1.08E+01 | ||
|
Methylation in Case |
3.20E-01 (Median) | Methylation in Control | 1.02E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg15562780) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.29E+00 | Statistic Test | p-value: 8.21E-10; Z-score: 5.64E+00 | ||
|
Methylation in Case |
3.38E-01 (Median) | Methylation in Control | 1.47E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg18494399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 5.34E+00 | Statistic Test | p-value: 1.52E-09; Z-score: 1.09E+01 | ||
|
Methylation in Case |
1.34E-01 (Median) | Methylation in Control | 2.51E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg10159951) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 1.02E-06; Z-score: 1.44E+00 | ||
|
Methylation in Case |
2.40E-01 (Median) | Methylation in Control | 1.53E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg08258650) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 6.29E-05; Z-score: 9.64E-01 | ||
|
Methylation in Case |
1.83E-01 (Median) | Methylation in Control | 1.38E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg21163960) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.04E-04; Z-score: 2.64E-01 | ||
|
Methylation in Case |
1.03E-01 (Median) | Methylation in Control | 9.10E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg25963980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 8.40E-04; Z-score: 1.30E+00 | ||
|
Methylation in Case |
5.76E-01 (Median) | Methylation in Control | 5.10E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS200 (cg17754876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 6.05E-07; Z-score: 8.28E-01 | ||
|
Methylation in Case |
1.67E-01 (Median) | Methylation in Control | 1.47E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS200 (cg07724977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 8.08E-07; Z-score: 8.83E-01 | ||
|
Methylation in Case |
4.19E-02 (Median) | Methylation in Control | 3.17E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS200 (cg25230151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 1.66E-06; Z-score: 1.23E+00 | ||
|
Methylation in Case |
2.09E-02 (Median) | Methylation in Control | 1.60E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg24944109) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.58E+00 | Statistic Test | p-value: 3.41E-10; Z-score: 4.39E+00 | ||
|
Methylation in Case |
3.40E-01 (Median) | Methylation in Control | 2.16E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg27457284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.72E+00 | Statistic Test | p-value: 1.35E-07; Z-score: 2.34E+00 | ||
|
Methylation in Case |
2.22E-01 (Median) | Methylation in Control | 1.30E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.89E-07; Z-score: -2.02E+00 | ||
|
Methylation in Case |
7.71E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg23501962) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 1.89E-07; Z-score: 1.97E+00 | ||
|
Methylation in Case |
3.40E-01 (Median) | Methylation in Control | 2.56E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg24183324) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 3.07E-07; Z-score: 1.69E+00 | ||
|
Methylation in Case |
1.61E-01 (Median) | Methylation in Control | 1.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg19653967) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 8.43E-06; Z-score: -1.25E+00 | ||
|
Methylation in Case |
6.96E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg13971030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.83E-04; Z-score: -7.63E-01 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 9.33E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg19112204) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.83E-03; Z-score: -7.43E-01 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg08411235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 4.86E-02; Z-score: 3.07E-01 | ||
|
Methylation in Case |
5.42E-01 (Median) | Methylation in Control | 5.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC1A2 in colorectal cancer | [ 6 ] | |||
|
Location |
3'UTR (cg26635576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.44E-04; Z-score: -1.53E+00 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg02577240) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.66E+00 | Statistic Test | p-value: 3.30E-17; Z-score: -3.58E+00 | ||
|
Methylation in Case |
4.02E-01 (Median) | Methylation in Control | 6.68E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg16104584) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 2.39E-13; Z-score: -2.48E+00 | ||
|
Methylation in Case |
2.48E-01 (Median) | Methylation in Control | 3.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg25963980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 2.02E-04; Z-score: -1.28E+00 | ||
|
Methylation in Case |
2.39E-01 (Median) | Methylation in Control | 3.03E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg10159951) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 1.95E-03; Z-score: -8.49E-01 | ||
|
Methylation in Case |
1.66E-01 (Median) | Methylation in Control | 2.12E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg08258650) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 1.72E-02; Z-score: -7.84E-01 | ||
|
Methylation in Case |
1.23E-01 (Median) | Methylation in Control | 1.57E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS1500 (cg18494399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 4.37E-02; Z-score: 3.99E-01 | ||
|
Methylation in Case |
1.73E-01 (Median) | Methylation in Control | 1.50E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
TSS200 (cg07724977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.72E+00 | Statistic Test | p-value: 1.23E-05; Z-score: -1.21E+00 | ||
|
Methylation in Case |
1.65E-01 (Median) | Methylation in Control | 2.83E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg14994247) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+00 | Statistic Test | p-value: 1.87E-18; Z-score: -3.60E+00 | ||
|
Methylation in Case |
3.14E-01 (Median) | Methylation in Control | 4.88E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg08411235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 4.63E-08; Z-score: -1.76E+00 | ||
|
Methylation in Case |
4.12E-01 (Median) | Methylation in Control | 5.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg19653967) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 2.81E-07; Z-score: -1.32E+00 | ||
|
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 6.19E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg19112204) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 1.26E-05; Z-score: -1.27E+00 | ||
|
Methylation in Case |
3.92E-01 (Median) | Methylation in Control | 5.11E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg10331829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.35E-03; Z-score: -5.92E-01 | ||
|
Methylation in Case |
8.10E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.75E-03; Z-score: -7.83E-01 | ||
|
Methylation in Case |
6.47E-01 (Median) | Methylation in Control | 6.94E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg21895324) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.11E-03; Z-score: -1.25E-01 | ||
|
Methylation in Case |
6.85E-01 (Median) | Methylation in Control | 6.95E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg20740024) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.37E-03; Z-score: -8.06E-01 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg23501962) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 2.35E-02; Z-score: -8.56E-01 | ||
|
Methylation in Case |
1.85E-01 (Median) | Methylation in Control | 2.28E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
Body (cg24183324) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 3.40E-02; Z-score: -9.89E-01 | ||
|
Methylation in Case |
1.46E-01 (Median) | Methylation in Control | 2.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg25475999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.19E-04; Z-score: -6.69E-01 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC1A2 in hepatocellular carcinoma | [ 7 ] | |||
|
Location |
3'UTR (cg26635576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 5.50E-04; Z-score: -1.13E+00 | ||
|
Methylation in Case |
8.57E-01 (Median) | Methylation in Control | 8.81E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg08258650) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 1.59E-04; Z-score: 7.89E-01 | ||
|
Methylation in Case |
5.13E-02 (Median) | Methylation in Control | 4.32E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg10159951) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 3.65E-04; Z-score: 8.72E-01 | ||
|
Methylation in Case |
5.98E-02 (Median) | Methylation in Control | 4.83E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg18494399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.88E+00 | Statistic Test | p-value: 4.81E-04; Z-score: 1.78E+00 | ||
|
Methylation in Case |
3.10E-02 (Median) | Methylation in Control | 1.65E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg15562780) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 1.12E-03; Z-score: 9.85E-01 | ||
|
Methylation in Case |
9.31E-02 (Median) | Methylation in Control | 8.02E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg24634422) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 1.19E-03; Z-score: 1.68E+00 | ||
|
Methylation in Case |
6.71E-02 (Median) | Methylation in Control | 4.26E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS1500 (cg21163960) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 2.70E-02; Z-score: 5.68E-01 | ||
|
Methylation in Case |
4.76E-02 (Median) | Methylation in Control | 4.04E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
TSS200 (cg17754876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 1.16E-03; Z-score: 1.12E+00 | ||
|
Methylation in Case |
1.01E-01 (Median) | Methylation in Control | 8.58E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg08411235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 5.19E-11; Z-score: 1.56E+00 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg13971030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 5.61E-11; Z-score: 1.61E+00 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg21818891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 6.53E-09; Z-score: -4.76E+00 | ||
|
Methylation in Case |
6.64E-01 (Median) | Methylation in Control | 8.49E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg21895324) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 3.10E-07; Z-score: -2.61E+00 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg10331829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.40E-05; Z-score: -1.57E+00 | ||
|
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 9.13E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg25961618) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.27E-05; Z-score: -1.50E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 8.07E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg19653967) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.56E-05; Z-score: 1.32E+00 | ||
|
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 6.13E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg27457284) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.25E+00 | Statistic Test | p-value: 1.24E-04; Z-score: 8.99E-01 | ||
|
Methylation in Case |
8.99E-02 (Median) | Methylation in Control | 7.17E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg24183324) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.16E+00 | Statistic Test | p-value: 7.87E-04; Z-score: 7.96E-01 | ||
|
Methylation in Case |
1.35E-01 (Median) | Methylation in Control | 1.16E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg19112204) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.13E-02; Z-score: -7.22E-01 | ||
|
Methylation in Case |
8.43E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.75E-02; Z-score: -4.11E-01 | ||
|
Methylation in Case |
8.86E-01 (Median) | Methylation in Control | 9.00E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC1A2 in HIV infection | [ 8 ] | |||
|
Location |
Body (cg13844463) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.41E-02; Z-score: -2.18E-01 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 5.61E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg18494399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 6.85E-04; Z-score: 7.34E-01 | ||
|
Methylation in Case |
5.48E-02 (Median) | Methylation in Control | 4.88E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg15562780) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 2.68E-02; Z-score: 4.21E-01 | ||
|
Methylation in Case |
7.43E-02 (Median) | Methylation in Control | 6.92E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS200 (cg07724977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 3.50E-03; Z-score: 2.31E-01 | ||
|
Methylation in Case |
6.26E-02 (Median) | Methylation in Control | 6.00E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
TSS200 (cg25230151) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 3.54E-02; Z-score: -2.51E-01 | ||
|
Methylation in Case |
4.46E-02 (Median) | Methylation in Control | 4.75E-02 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg21818891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.94E-08; Z-score: -1.80E+00 | ||
|
Methylation in Case |
8.23E-01 (Median) | Methylation in Control | 8.76E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg13844463) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 5.61E-07; Z-score: -1.03E+00 | ||
|
Methylation in Case |
6.07E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg25961618) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.95E-03; Z-score: -4.54E-01 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 7.90E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg14746605) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 3.56E-03; Z-score: 6.16E-01 | ||
|
Methylation in Case |
6.84E-01 (Median) | Methylation in Control | 6.38E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 3.67E-03; Z-score: 9.56E-01 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 6.65E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg20740024) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.07E-02; Z-score: 6.12E-01 | ||
|
Methylation in Case |
8.87E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A2 in papillary thyroid cancer | [ 9 ] | |||
|
Location |
Body (cg23501962) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.64E-02; Z-score: -8.42E-01 | ||
|
Methylation in Case |
1.77E-01 (Median) | Methylation in Control | 2.03E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in systemic lupus erythematosus | [ 10 ] | |||
|
Location |
TSS1500 (cg25963980) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.75E-02; Z-score: -8.09E-02 | ||
|
Methylation in Case |
2.42E-01 (Median) | Methylation in Control | 2.48E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in systemic lupus erythematosus | [ 10 ] | |||
|
Location |
Body (cg19653967) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.26E-02; Z-score: -2.06E-01 | ||
|
Methylation in Case |
7.19E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in systemic lupus erythematosus | [ 10 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.34E-02; Z-score: -2.14E-01 | ||
|
Methylation in Case |
8.60E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in systemic lupus erythematosus | [ 10 ] | |||
|
Location |
Body (cg22934516) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 4.48E-02; Z-score: -1.00E-01 | ||
|
Methylation in Case |
1.26E-01 (Median) | Methylation in Control | 1.31E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in atypical teratoid rhabdoid tumor | [ 11 ] | |||
|
Location |
Body (cg04987335) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.12E-03; Z-score: -7.94E-01 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 8.94E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in atypical teratoid rhabdoid tumor | [ 11 ] | |||
|
Location |
Body (cg08411235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 6.21E-03; Z-score: 5.52E-01 | ||
|
Methylation in Case |
8.69E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in atypical teratoid rhabdoid tumor | [ 11 ] | |||
|
Location |
Body (cg10331829) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.43E-02; Z-score: -4.97E-01 | ||
|
Methylation in Case |
8.61E-01 (Median) | Methylation in Control | 8.88E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in atypical teratoid rhabdoid tumor | [ 11 ] | |||
|
Location |
Body (cg13844463) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.93E-02; Z-score: -5.16E-01 | ||
|
Methylation in Case |
1.40E-01 (Median) | Methylation in Control | 1.55E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in atypical teratoid rhabdoid tumor | [ 11 ] | |||
|
Location |
Body (cg13971030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 4.04E-02; Z-score: -5.58E-01 | ||
|
Methylation in Case |
2.59E-01 (Median) | Methylation in Control | 3.14E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A2 in atypical teratoid rhabdoid tumor | [ 11 ] | |||
|
Location |
3'UTR (cg25475999) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.06E-09; Z-score: -1.63E+00 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 9.04E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A2 in atypical teratoid rhabdoid tumor | [ 11 ] | |||
|
Location |
3'UTR (cg26635576) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.57E+00 | Statistic Test | p-value: 3.04E-09; Z-score: 1.47E+00 | ||
|
Methylation in Case |
4.79E-01 (Median) | Methylation in Control | 3.06E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in depression | [ 12 ] | |||
|
Location |
Body (cg13971030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.43E-02; Z-score: 4.68E-01 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 6.31E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
3 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg13971030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 3.72E-03; Z-score: 1.48E+00 | ||
|
Methylation in Case |
7.95E-01 (Median) | Methylation in Control | 7.12E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg08411235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.28E+00 | Statistic Test | p-value: 5.73E-03; Z-score: 2.44E+00 | ||
|
Methylation in Case |
6.61E-01 (Median) | Methylation in Control | 5.14E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in lung adenocarcinoma | [ 13 ] | |||
|
Location |
Body (cg21818891) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.80E-02; Z-score: -3.27E+00 | ||
|
Methylation in Case |
7.07E-01 (Median) | Methylation in Control | 7.98E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in panic disorder | [ 14 ] | |||
|
Location |
Body (cg19112204) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.16E-02; Z-score: 2.38E-01 | ||
|
Methylation in Case |
3.10E+00 (Median) | Methylation in Control | 3.00E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A2 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg09243106) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 6.21E-03; Z-score: 2.40E+00 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A2 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg08737116) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.91E+00 | Statistic Test | p-value: 8.01E-03; Z-score: -2.66E+00 | ||
|
Methylation in Case |
2.93E-01 (Median) | Methylation in Control | 5.59E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A2 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg19503341) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 8.34E-03; Z-score: -3.13E+00 | ||
|
Methylation in Case |
3.55E-01 (Median) | Methylation in Control | 4.73E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A2 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg03107235) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.78E+00 | Statistic Test | p-value: 1.93E-02; Z-score: 3.04E+00 | ||
|
Methylation in Case |
5.19E-01 (Median) | Methylation in Control | 2.91E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A2 in prostate cancer | [ 15 ] | |||
|
Location |
Body (cg17330838) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.70E+00 | Statistic Test | p-value: 4.70E-02; Z-score: -2.42E+00 | ||
|
Methylation in Case |
2.41E-01 (Median) | Methylation in Control | 4.10E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Nodular goiter |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypomethylation of SLC1A2 in nodular goiter | [ 16 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Methylation-specific PCR | ||
|
Studied Phenotype |
Nodular goiter [ ICD-11: 5A01.Z] | ||||
|
Experimental Material |
Multiple cell lines of human; Patient tissue samples | ||||
|
Additional Notes |
A distinct methylation profiling in drug metabolism and transport genes between nodular goiter and normal thyroid tissues, particularly ABCB4, CYP1B1 and CYP24A1 and SLC1A2. | ||||
|
Hemangioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC1A2 in hemangioblastoma than that in healthy individual | ||||
Studied Phenotype |
Hemangioblastoma [ICD-11:2F7C] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.17E-12; Fold-change: 0.215642809; Z-score: 4.406871521 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypermethylation of SLC1A2 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.30E-09; Fold-change: 0.410154074; Z-score: 11.24560094 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
microRNA |
|||||
|
Unclear Phenotype |
44 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-1273h directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1273h | miRNA Mature ID | miR-1273h-5p | ||
|
miRNA Sequence |
CUGGGAGGUCAAGGCUGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-1324 directly targets SLC1A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1324 | miRNA Mature ID | miR-1324 | ||
|
miRNA Sequence |
CCAGACAGAAUUCUAUGCACUUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 3 |
miR-149 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-149 | miRNA Mature ID | miR-149-3p | ||
|
miRNA Sequence |
AGGGAGGGACGGGGGCUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-15a directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-3p | ||
|
miRNA Sequence |
CAGGCCAUAUUGUGCUGCCUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-1908 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1908 | miRNA Mature ID | miR-1908-5p | ||
|
miRNA Sequence |
CGGCGGGGACGGCGAUUGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-1910 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1910 | miRNA Mature ID | miR-1910-5p | ||
|
miRNA Sequence |
CCAGUCCUGUGCCUGCCGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-24 directly targets SLC1A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-24 | miRNA Mature ID | miR-24-3p | ||
|
miRNA Sequence |
UGGCUCAGUUCAGCAGGAACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-30a directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-30a | miRNA Mature ID | miR-30a-3p | ||
|
miRNA Sequence |
CUUUCAGUCGGAUGUUUGCAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-30b directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-30b | miRNA Mature ID | miR-30b-3p | ||
|
miRNA Sequence |
CUGGGAGGUGGAUGUUUACUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-30c-1 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-30c-1 | miRNA Mature ID | miR-30c-1-3p | ||
|
miRNA Sequence |
CUGGGAGAGGGUUGUUUACUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-30c-2 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-30c-2 | miRNA Mature ID | miR-30c-2-3p | ||
|
miRNA Sequence |
CUGGGAGAAGGCUGUUUACUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-30d directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-30d | miRNA Mature ID | miR-30d-3p | ||
|
miRNA Sequence |
CUUUCAGUCAGAUGUUUGCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-30e directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-30e | miRNA Mature ID | miR-30e-3p | ||
|
miRNA Sequence |
CUUUCAGUCGGAUGUUUACAGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 14 |
miR-3122 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3122 | miRNA Mature ID | miR-3122 | ||
|
miRNA Sequence |
GUUGGGACAAGAGGACGGUCUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 15 |
miR-3176 directly targets SLC1A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3176 | miRNA Mature ID | miR-3176 | ||
|
miRNA Sequence |
ACUGGCCUGGGACUACCGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-3190 directly targets SLC1A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3190 | miRNA Mature ID | miR-3190-5p | ||
|
miRNA Sequence |
UCUGGCCAGCUACGUCCCCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 17 |
miR-3689a directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3689a | miRNA Mature ID | miR-3689a-3p | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUCGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 18 |
miR-3689b directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3689b | miRNA Mature ID | miR-3689b-3p | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-3689c directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3689c | miRNA Mature ID | miR-3689c | ||
|
miRNA Sequence |
CUGGGAGGUGUGAUAUUGUGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 20 |
miR-383 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-383 | miRNA Mature ID | miR-383-3p | ||
|
miRNA Sequence |
ACAGCACUGCCUGGUCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 21 |
miR-3913 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3913 | miRNA Mature ID | miR-3913-5p | ||
|
miRNA Sequence |
UUUGGGACUGAUCUUGAUGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-3922 directly targets SLC1A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3922 | miRNA Mature ID | miR-3922-3p | ||
|
miRNA Sequence |
UCUGGCCUUGACUUGACUCUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 23 |
miR-4284 directly targets SLC1A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4284 | miRNA Mature ID | miR-4284 | ||
|
miRNA Sequence |
GGGCUCACAUCACCCCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 24 |
miR-455 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-455 | miRNA Mature ID | miR-455-3p | ||
|
miRNA Sequence |
GCAGUCCAUGGGCAUAUACAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-4728 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4728 | miRNA Mature ID | miR-4728-5p | ||
|
miRNA Sequence |
UGGGAGGGGAGAGGCAGCAAGCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 26 |
miR-4743 directly targets SLC1A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4743 | miRNA Mature ID | miR-4743-5p | ||
|
miRNA Sequence |
UGGCCGGAUGGGACAGGAGGCAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 27 |
miR-497 directly targets SLC1A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-497 | miRNA Mature ID | miR-497-3p | ||
|
miRNA Sequence |
CAAACCACACUGUGGUGUUAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 28 |
miR-500a directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-500a | miRNA Mature ID | miR-500a-5p | ||
|
miRNA Sequence |
UAAUCCUUGCUACCUGGGUGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 29 |
miR-501 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-501 | miRNA Mature ID | miR-501-5p | ||
|
miRNA Sequence |
AAUCCUUUGUCCCUGGGUGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 30 |
miR-548as directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-548as | miRNA Mature ID | miR-548as-3p | ||
|
miRNA Sequence |
UAAAACCCACAAUUAUGUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 31 |
miR-564 directly targets SLC1A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-564 | miRNA Mature ID | miR-564 | ||
|
miRNA Sequence |
AGGCACGGUGUCAGCAGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 32 |
miR-6513 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6513 | miRNA Mature ID | miR-6513-5p | ||
|
miRNA Sequence |
UUUGGGAUUGACGCCACAUGUCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 33 |
miR-663a directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-663a | miRNA Mature ID | miR-663a | ||
|
miRNA Sequence |
AGGCGGGGCGCCGCGGGACCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 34 |
miR-6776 directly targets SLC1A2 | [ 18 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6776 | miRNA Mature ID | miR-6776-3p | ||
|
miRNA Sequence |
CAACCACCACUGUCUCUCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 35 |
miR-6779 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6779 | miRNA Mature ID | miR-6779-5p | ||
|
miRNA Sequence |
CUGGGAGGGGCUGGGUUUGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 36 |
miR-6780a directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6780a | miRNA Mature ID | miR-6780a-5p | ||
|
miRNA Sequence |
UUGGGAGGGAAGACAGCUGGAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 37 |
miR-6785 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6785 | miRNA Mature ID | miR-6785-5p | ||
|
miRNA Sequence |
UGGGAGGGCGUGGAUGAUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 38 |
miR-6787 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6787 | miRNA Mature ID | miR-6787-5p | ||
|
miRNA Sequence |
UGGCGGGGGUAGAGCUGGCUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 39 |
miR-6788 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6788 | miRNA Mature ID | miR-6788-5p | ||
|
miRNA Sequence |
CUGGGAGAAGAGUGGUGAAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 40 |
miR-6799 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6799 | miRNA Mature ID | miR-6799-5p | ||
|
miRNA Sequence |
GGGGAGGUGUGCAGGGCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 41 |
miR-6883 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6883 | miRNA Mature ID | miR-6883-5p | ||
|
miRNA Sequence |
AGGGAGGGUGUGGUAUGGAUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 42 |
miR-7106 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7106 | miRNA Mature ID | miR-7106-5p | ||
|
miRNA Sequence |
UGGGAGGAGGGGAUCUUGGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 43 |
miR-7977 directly targets SLC1A2 | [ 19 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7977 | miRNA Mature ID | miR-7977 | ||
|
miRNA Sequence |
UUCCCAGCCAACGCACCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 44 |
miR-887 directly targets SLC1A2 | [ 17 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-887 | miRNA Mature ID | miR-887-5p | ||
|
miRNA Sequence |
CUUGGGAGCCCUGUUAGACUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.