Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0133 Transporter Info
Gene Name SLC1A5
Transporter Name Alanine/serine/cysteine/threonine transporter 2
Gene ID
6510
UniProt ID
Q15758
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A5 in bladder cancer [ 1 ]

Location

 TSS1500 (cg08533710)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 2.73E-02; Z-score: -2.13E+00

Methylation in Case

 3.93E-01 (Median) Methylation in Control 4.79E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A5 in breast cancer [ 2 ]

Location

 TSS1500 (cg23391214)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.61E+00 Statistic Test p-value: 1.47E-03; Z-score: -1.94E+00

Methylation in Case

 7.72E-02 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A5 in breast cancer [ 2 ]

Location

 TSS1500 (cg08533710)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.90E-02; Z-score: -1.44E+00

Methylation in Case

 4.78E-01 (Median) Methylation in Control 5.57E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A5 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg08533710)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 6.80E-03; Z-score: 7.57E-01

Methylation in Case

 6.24E-01 (Median) Methylation in Control 5.86E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A5 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg23391214)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.83E+00 Statistic Test p-value: 1.67E-04; Z-score: -1.61E+00

Methylation in Case

 2.43E-01 (Median) Methylation in Control 4.45E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A5 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg12297570)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 1.00E-03; Z-score: 8.01E-01

Methylation in Case

 9.37E-02 (Median) Methylation in Control 8.42E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC1A5 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg08533710)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.06E-02; Z-score: -6.49E-01

Methylation in Case

 6.80E-01 (Median) Methylation in Control 7.34E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A5 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg08533710)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 7.23E-05; Z-score: 6.30E-01

Methylation in Case

 6.12E-01 (Median) Methylation in Control 5.46E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A5 in systemic lupus erythematosus [ 6 ]

Location

 TSS1500 (cg23391214)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 3.25E-03; Z-score: -2.16E-01

Methylation in Case

 8.71E-02 (Median) Methylation in Control 9.16E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A5 in colon adenocarcinoma [ 7 ]

Location

 TSS200 (cg20551181)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 1.05E-03; Z-score: 9.75E-01

Methylation in Case

 4.64E-01 (Median) Methylation in Control 3.65E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg22708635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.07E-04; Z-score: 9.88E-01

Methylation in Case

 7.46E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A5 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg09481056)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.17E-02; Z-score: -1.48E-01

Methylation in Case

 8.05E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Rheumatoid arthritis

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypomethylation of SLC1A5 in rheumatoid arthritis [ 10 ]

Epigenetic Type

 Methylation Experiment Method HumanMethylation450 BeadChip

Studied Phenotype

 Rheumatoid arthritis [ ICD-11: FA20]

Experimental Material

 Patient tissue samples

Additional Notes

 SLC1A5 was the most hypermethyaltion gene in rheumatoid arthritis.

  Craniopharyngioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC1A5 in craniopharyngioma than that in healthy individual

Studied Phenotype

 Craniopharyngioma [ICD-11:2F9A]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 6.42E-17; Fold-change: -0.436998223; Z-score: -10.59168556
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Esthesioneuroblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC1A5 in esthesioneuroblastoma than that in healthy individual

Studied Phenotype

 Esthesioneuroblastoma [ICD-11:2D50.1]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 6.96E-18; Fold-change: -0.44574971; Z-score: -11.75569871
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Obesity

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC1A5 in obesity than that in healthy individual

Studied Phenotype

 Obesity [ICD-11:5B81]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 3.40E-13; Fold-change: -0.310174486; Z-score: -3.20449883
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

Histone acetylation

  Chronic social defeat stress

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hyperacetylation of SLC1A5 in chronic social defeat stress (compare with normal control mice) [ 9 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Up regulation of SLC1A5 Experiment Method RT-qPCR

Studied Phenotype

 Chronic social defeat stress [ ICD-11: QE01]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 Chronic social stress activates ASCT2 transcription via histone acetylation in its promoter.

  Epigenetic Phenomenon 2

 Hyperacetylation of SLC1A5 in chronic social defeat stress (compare with normal control mice) [ 9 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Up regulation of SLC1A5 Experiment Method RT-qPCR

Studied Phenotype

 Chronic social defeat stress [ ICD-11: QE01]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 Chronic social stress activates ASCT2 transcription via histone acetylation in its promoter.

microRNA

  Unclear Phenotype

        160 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-106a directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-106a miRNA Mature ID miR-106a-5p

miRNA Sequence

 AAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-106b directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-106b miRNA Mature ID miR-106b-5p

miRNA Sequence

 UAAAGUGCUGACAGUGCAGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-122 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-122 miRNA Mature ID miR-122-5p

miRNA Sequence

 UGGAGUGUGACAAUGGUGUUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1224 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1224 miRNA Mature ID miR-1224-3p

miRNA Sequence

 CCCCACCUCCUCUCUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-1226 directly targets SLC1A5 [ 13 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-1226 miRNA Mature ID miR-1226-3p

miRNA Sequence

 UCACCAGCCCUGUGUUCCCUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-1227 directly targets SLC1A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1227 miRNA Mature ID miR-1227-3p

miRNA Sequence

 CGUGCCACCCUUUUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 7

 miR-1234 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1234 miRNA Mature ID miR-1234-3p

miRNA Sequence

 UCGGCCUGACCACCCACCCCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-125a directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-125a miRNA Mature ID miR-125a-3p

miRNA Sequence

 ACAGGUGAGGUUCUUGGGAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-125a directly targets SLC1A5 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-125a miRNA Mature ID miR-125a-5p

miRNA Sequence

 UCCCUGAGACCCUUUAACCUGUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-1260a directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1260a miRNA Mature ID miR-1260a

miRNA Sequence

 AUCCCACCUCUGCCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-1260b directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1260b miRNA Mature ID miR-1260b

miRNA Sequence

 AUCCCACCACUGCCACCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-1267 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1267 miRNA Mature ID miR-1267

miRNA Sequence

 CCUGUUGAAGUGUAAUCCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-1295b directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1295b miRNA Mature ID miR-1295b-3p

miRNA Sequence

 AAUAGGCCACGGAUCUGGGCAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-1304 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1304 miRNA Mature ID miR-1304-3p

miRNA Sequence

 UCUCACUGUAGCCUCGAACCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-1307 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1307 miRNA Mature ID miR-1307-3p

miRNA Sequence

 ACUCGGCGUGGCGUCGGUCGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-143 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-143 miRNA Mature ID miR-143-5p

miRNA Sequence

 GGUGCAGUGCUGCAUCUCUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-149 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-149 miRNA Mature ID miR-149-3p

miRNA Sequence

 AGGGAGGGACGGGGGCUGUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-150 directly targets SLC1A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-150 miRNA Mature ID miR-150-5p

miRNA Sequence

 UCUCCCAACCCUUGUACCAGUG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 19

 miR-155 directly targets SLC1A5 [ 17 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-155 miRNA Mature ID miR-155-5p

miRNA Sequence

 UUAAUGCUAAUCGUGAUAGGGGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 20

 miR-15a directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-15a miRNA Mature ID miR-15a-3p

miRNA Sequence

 CAGGCCAUAUUGUGCUGCCUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-15b directly targets SLC1A5 [ 13 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

 UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 22

 miR-16 directly targets SLC1A5 [ 13 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 23

 miR-17 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-17 miRNA Mature ID miR-17-5p

miRNA Sequence

 CAAAGUGCUUACAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-186 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-3p

miRNA Sequence

 GCCCAAAGGUGAAUUUUUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-188 directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-188 miRNA Mature ID miR-188-3p

miRNA Sequence

 CUCCCACAUGCAGGGUUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-193b directly targets SLC1A5 [ 18 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-3p

miRNA Sequence

 AACUGGCCCUCAAAGUCCCGCU

miRNA Target Type

 Direct

Experimental Material

 Human breast adenocarcinoma cell line (MCF-7)

  Epigenetic Phenomenon 27

 miR-1976 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

 CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-20a directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-20a miRNA Mature ID miR-20a-5p

miRNA Sequence

 UAAAGUGCUUAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-20b directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-20b miRNA Mature ID miR-20b-5p

miRNA Sequence

 CAAAGUGCUCAUAGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-214 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-214 miRNA Mature ID miR-214-5p

miRNA Sequence

 UGCCUGUCUACACUUGCUGUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-218 directly targets SLC1A5 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-218 miRNA Mature ID miR-218-5p

miRNA Sequence

 UUGUGCUUGAUCUAACCAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-2276 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2276 miRNA Mature ID miR-2276-3p

miRNA Sequence

 UCUGCAAGUGUCAGAGGCGAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-23a directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-23a miRNA Mature ID miR-23a-5p

miRNA Sequence

 GGGGUUCCUGGGGAUGGGAUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-23b directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-23b miRNA Mature ID miR-23b-5p

miRNA Sequence

 UGGGUUCCUGGCAUGCUGAUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-24 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-24 miRNA Mature ID miR-24-3p

miRNA Sequence

 UGGCUCAGUUCAGCAGGAACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-2681 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2681 miRNA Mature ID miR-2681-3p

miRNA Sequence

 UAUCAUGGAGUUGGUAAAGCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-29a directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29a miRNA Mature ID miR-29a-5p

miRNA Sequence

 ACUGAUUUCUUUUGGUGUUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-302a directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-302a miRNA Mature ID miR-302a-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUUGGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-302b directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-302b miRNA Mature ID miR-302b-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUUAGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-302c directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-302c miRNA Mature ID miR-302c-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUCAGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 41

 miR-302d directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-302d miRNA Mature ID miR-302d-3p

miRNA Sequence

 UAAGUGCUUCCAUGUUUGAGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-302e directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-302e miRNA Mature ID miR-302e

miRNA Sequence

 UAAGUGCUUCCAUGCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-30b directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-30b miRNA Mature ID miR-30b-3p

miRNA Sequence

 CUGGGAGGUGGAUGUUUACUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-3122 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3122 miRNA Mature ID miR-3122

miRNA Sequence

 GUUGGGACAAGAGGACGGUCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 45

 miR-3130 directly targets SLC1A5 [ 21 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3130 miRNA Mature ID miR-3130-3p

miRNA Sequence

 GCUGCACCGGAGACUGGGUAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

 miR-3135b directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3135b miRNA Mature ID miR-3135b

miRNA Sequence

 GGCUGGAGCGAGUGCAGUGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-3156 directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3156 miRNA Mature ID miR-3156-3p

miRNA Sequence

 CUCCCACUUCCAGAUCUUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-3159 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3159 miRNA Mature ID miR-3159

miRNA Sequence

 UAGGAUUACAAGUGUCGGCCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 49

 miR-3192 directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3192 miRNA Mature ID miR-3192-3p

miRNA Sequence

 CUCUGAUCGCCCUCUCAGCUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 50

 miR-3199 directly targets SLC1A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3199 miRNA Mature ID miR-3199

miRNA Sequence

 AGGGACUGCCUUAGGAGAAAGUU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 51

 miR-324 directly targets SLC1A5 [ 13 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-324 miRNA Mature ID miR-324-3p

miRNA Sequence

 CCCACUGCCCCAGGUGCUGCUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 52

 miR-330 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-330 miRNA Mature ID miR-330-3p

miRNA Sequence

 GCAAAGCACACGGCCUGCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 53

 miR-331 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-331 miRNA Mature ID miR-331-3p

miRNA Sequence

 GCCCCUGGGCCUAUCCUAGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 54

 miR-34a directly targets SLC1A5 [ 22 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-34a miRNA Mature ID miR-34a-5p

miRNA Sequence

 UGGCAGUGUCUUAGCUGGUUGU

miRNA Target Type

 Direct

Experimental Material

 Human colorectal cancer cell line (SW480)

  Epigenetic Phenomenon 55

 miR-3622b directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3622b miRNA Mature ID miR-3622b-5p

miRNA Sequence

 AGGCAUGGGAGGUCAGGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-3652 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3652 miRNA Mature ID miR-3652

miRNA Sequence

 CGGCUGGAGGUGUGAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-365a directly targets SLC1A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-365a miRNA Mature ID miR-365a-5p

miRNA Sequence

 AGGGACUUUUGGGGGCAGAUGUG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 58

 miR-365b directly targets SLC1A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-365b miRNA Mature ID miR-365b-5p

miRNA Sequence

 AGGGACUUUCAGGGGCAGCUGU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 59

 miR-3664 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3664 miRNA Mature ID miR-3664-5p

miRNA Sequence

 AACUCUGUCUUCACUCAUGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 60

 miR-367 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-367 miRNA Mature ID miR-367-5p

miRNA Sequence

 ACUGUUGCUAAUAUGCAACUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 61

 miR-3689c directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3689c miRNA Mature ID miR-3689c

miRNA Sequence

 CUGGGAGGUGUGAUAUUGUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 62

 miR-372 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-372 miRNA Mature ID miR-372-3p

miRNA Sequence

 AAAGUGCUGCGACAUUUGAGCGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 63

 miR-373 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-373 miRNA Mature ID miR-373-3p

miRNA Sequence

 GAAGUGCUUCGAUUUUGGGGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 64

 miR-378a directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-378a miRNA Mature ID miR-378a-5p

miRNA Sequence

 CUCCUGACUCCAGGUCCUGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 65

 miR-383 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-383 miRNA Mature ID miR-383-3p

miRNA Sequence

 ACAGCACUGCCUGGUCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 66

 miR-3909 directly targets SLC1A5 [ 23 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3909 miRNA Mature ID miR-3909

miRNA Sequence

 UGUCCUCUAGGGCCUGCAGUCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 67

 miR-3913 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3913 miRNA Mature ID miR-3913-5p

miRNA Sequence

 UUUGGGACUGAUCUUGAUGUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 68

 miR-3920 directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3920 miRNA Mature ID miR-3920

miRNA Sequence

 ACUGAUUAUCUUAACUCUCUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 69

 miR-3926 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3926 miRNA Mature ID miR-3926

miRNA Sequence

 UGGCCAAAAAGCAGGCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 70

 miR-3934 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3934 miRNA Mature ID miR-3934-5p

miRNA Sequence

 UCAGGUGUGGAAACUGAGGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 71

 miR-3940 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3940 miRNA Mature ID miR-3940-5p

miRNA Sequence

 GUGGGUUGGGGCGGGCUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 72

 miR-4252 directly targets SLC1A5 [ 21 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4252 miRNA Mature ID miR-4252

miRNA Sequence

 GGCCACUGAGUCAGCACCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 73

 miR-4279 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

 CUCUCCUCCCGGCUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 74

 miR-4284 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4284 miRNA Mature ID miR-4284

miRNA Sequence

 GGGCUCACAUCACCCCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 75

 miR-4292 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4292 miRNA Mature ID miR-4292

miRNA Sequence

 CCCCUGGGCCGGCCUUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 76

 miR-4313 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4313 miRNA Mature ID miR-4313

miRNA Sequence

 AGCCCCCUGGCCCCAAACCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 77

 miR-433 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-433 miRNA Mature ID miR-433-3p

miRNA Sequence

 AUCAUGAUGGGCUCCUCGGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 78

 miR-4423 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4423 miRNA Mature ID miR-4423-5p

miRNA Sequence

 AGUUGCCUUUUUGUUCCCAUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 79

 miR-4430 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4430 miRNA Mature ID miR-4430

miRNA Sequence

 AGGCUGGAGUGAGCGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 80

 miR-4436b directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4436b miRNA Mature ID miR-4436b-5p

miRNA Sequence

 GUCCACUUCUGCCUGCCCUGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 81

 miR-4438 directly targets SLC1A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4438 miRNA Mature ID miR-4438

miRNA Sequence

 CACAGGCUUAGAAAAGACAGU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 82

 miR-4454 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4454 miRNA Mature ID miR-4454

miRNA Sequence

 GGAUCCGAGUCACGGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 83

 miR-4507 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4507 miRNA Mature ID miR-4507

miRNA Sequence

 CUGGGUUGGGCUGGGCUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 84

 miR-455 directly targets SLC1A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-455 miRNA Mature ID miR-455-5p

miRNA Sequence

 UAUGUGCCUUUGGACUACAUCG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 85

 miR-4638 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4638 miRNA Mature ID miR-4638-5p

miRNA Sequence

 ACUCGGCUGCGGUGGACAAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 86

 miR-4639 directly targets SLC1A5 [ 23 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4639 miRNA Mature ID miR-4639-5p

miRNA Sequence

 UUGCUAAGUAGGCUGAGAUUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 87

 miR-4690 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4690 miRNA Mature ID miR-4690-5p

miRNA Sequence

 GAGCAGGCGAGGCUGGGCUGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 88

 miR-4715 directly targets SLC1A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4715 miRNA Mature ID miR-4715-3p

miRNA Sequence

 GUGCCACCUUAACUGCAGCCAAU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 89

 miR-4717 directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4717 miRNA Mature ID miR-4717-5p

miRNA Sequence

 UAGGCCACAGCCACCCAUGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 90

 miR-4722 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

 ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 91

 miR-4728 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4728 miRNA Mature ID miR-4728-5p

miRNA Sequence

 UGGGAGGGGAGAGGCAGCAAGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 92

 miR-4742 directly targets SLC1A5 [ 21 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4742 miRNA Mature ID miR-4742-3p

miRNA Sequence

 UCUGUAUUCUCCUUUGCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 93

 miR-4762 directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4762 miRNA Mature ID miR-4762-3p

miRNA Sequence

 CUUCUGAUCAAGAUUUGUGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 94

 miR-4772 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4772 miRNA Mature ID miR-4772-3p

miRNA Sequence

 CCUGCAACUUUGCCUGAUCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 95

 miR-500b directly targets SLC1A5 [ 21 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-500b miRNA Mature ID miR-500b-3p

miRNA Sequence

 GCACCCAGGCAAGGAUUCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 96

 miR-504 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-504 miRNA Mature ID miR-504-3p

miRNA Sequence

 GGGAGUGCAGGGCAGGGUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 97

 miR-519d directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-519d miRNA Mature ID miR-519d-3p

miRNA Sequence

 CAAAGUGCCUCCCUUUAGAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 98

 miR-520a directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-520a miRNA Mature ID miR-520a-3p

miRNA Sequence

 AAAGUGCUUCCCUUUGGACUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 99

 miR-520c directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-520c miRNA Mature ID miR-520c-3p

miRNA Sequence

 AAAGUGCUUCCUUUUAGAGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 100

 miR-520d directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-520d miRNA Mature ID miR-520d-3p

miRNA Sequence

 AAAGUGCUUCUCUUUGGUGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 101

 miR-520g directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-520g miRNA Mature ID miR-520g-3p

miRNA Sequence

 ACAAAGUGCUUCCCUUUAGAGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 102

 miR-520h directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-520h miRNA Mature ID miR-520h

miRNA Sequence

 ACAAAGUGCUUCCCUUUAGAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 103

 miR-526b directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-526b miRNA Mature ID miR-526b-3p

miRNA Sequence

 GAAAGUGCUUCCUUUUAGAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 104

 miR-552 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-552 miRNA Mature ID miR-552-3p

miRNA Sequence

 AACAGGUGACUGGUUAGACAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 105

 miR-562 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-562 miRNA Mature ID miR-562

miRNA Sequence

 AAAGUAGCUGUACCAUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 106

 miR-5693 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5693 miRNA Mature ID miR-5693

miRNA Sequence

 GCAGUGGCUCUGAAAUGAACUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 107

 miR-5697 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5697 miRNA Mature ID miR-5697

miRNA Sequence

 UCAAGUAGUUUCAUGAUAAAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 108

 miR-5698 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5698 miRNA Mature ID miR-5698

miRNA Sequence

 UGGGGGAGUGCAGUGAUUGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 109

 miR-5704 directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5704 miRNA Mature ID miR-5704

miRNA Sequence

 UUAGGCCAUCAUCCCAUUAUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 110

 miR-589 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-589 miRNA Mature ID miR-589-3p

miRNA Sequence

 UCAGAACAAAUGCCGGUUCCCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 111

 miR-590 directly targets SLC1A5 [ 23 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-590 miRNA Mature ID miR-590-3p

miRNA Sequence

 UAAUUUUAUGUAUAAGCUAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 112

 miR-619 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-619 miRNA Mature ID miR-619-5p

miRNA Sequence

 GCUGGGAUUACAGGCAUGAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 113

 miR-635 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-635 miRNA Mature ID miR-635

miRNA Sequence

 ACUUGGGCACUGAAACAAUGUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 114

 miR-640 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-640 miRNA Mature ID miR-640

miRNA Sequence

 AUGAUCCAGGAACCUGCCUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 115

 miR-6499 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

 AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 116

 miR-6501 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6501 miRNA Mature ID miR-6501-5p

miRNA Sequence

 AGUUGCCAGGGCUGCCUUUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 117

 miR-6504 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6504 miRNA Mature ID miR-6504-3p

miRNA Sequence

 CAUUACAGCACAGCCAUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 118

 miR-6513 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6513 miRNA Mature ID miR-6513-5p

miRNA Sequence

 UUUGGGAUUGACGCCACAUGUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 119

 miR-6514 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6514 miRNA Mature ID miR-6514-3p

miRNA Sequence

 CUGCCUGUUCUUCCACUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 120

 miR-6727 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

 UCCUGCCACCUCCUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 121

 miR-6729 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6729 miRNA Mature ID miR-6729-3p

miRNA Sequence

 UCAUCCCCCUCGCCCUCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 122

 miR-6741 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6741 miRNA Mature ID miR-6741-3p

miRNA Sequence

 UCGGCUCUCUCCCUCACCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 123

 miR-6742 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6742 miRNA Mature ID miR-6742-3p

miRNA Sequence

 ACCUGGGUUGUCCCCUCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 124

 miR-6746 directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6746 miRNA Mature ID miR-6746-3p

miRNA Sequence

 CAGCCGCCGCCUGUCUCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 125

 miR-6747 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

 UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 126

 miR-6767 directly targets SLC1A5 [ 24 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6767 miRNA Mature ID miR-6767-3p

miRNA Sequence

 CCACGUGCUUCUCUUUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 127

 miR-6774 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6774 miRNA Mature ID miR-6774-5p

miRNA Sequence

 ACUUGGGCAGGAGGGACCCUGUAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 128

 miR-6778 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

 UGCCUCCCUGACAUUCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 129

 miR-6779 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6779 miRNA Mature ID miR-6779-5p

miRNA Sequence

 CUGGGAGGGGCUGGGUUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 130

 miR-6780a directly targets SLC1A5 [ 23 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6780a miRNA Mature ID miR-6780a-3p

miRNA Sequence

 CUCCUCUGUUUUCUUUCCUAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 131

 miR-6785 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6785 miRNA Mature ID miR-6785-5p

miRNA Sequence

 UGGGAGGGCGUGGAUGAUGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 132

 miR-6788 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6788 miRNA Mature ID miR-6788-5p

miRNA Sequence

 CUGGGAGAAGAGUGGUGAAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 133

 miR-6790 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6790 miRNA Mature ID miR-6790-3p

miRNA Sequence

 CGACCUCGGCGACCCCUCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 134

 miR-6791 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6791 miRNA Mature ID miR-6791-5p

miRNA Sequence

 CCCCUGGGGCUGGGCAGGCGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 135

 miR-6799 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6799 miRNA Mature ID miR-6799-5p

miRNA Sequence

 GGGGAGGUGUGCAGGGCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 136

 miR-6807 directly targets SLC1A5 [ 21 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

 GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 137

 miR-6811 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6811 miRNA Mature ID miR-6811-3p

miRNA Sequence

 AGCCUGUGCUUGUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 138

 miR-6814 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6814 miRNA Mature ID miR-6814-5p

miRNA Sequence

 UCCCAAGGGUGAGAUGCUGCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 139

 miR-6821 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6821 miRNA Mature ID miR-6821-3p

miRNA Sequence

 UGACCUCUCCGCUCCGCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 140

 miR-6821 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6821 miRNA Mature ID miR-6821-5p

miRNA Sequence

 GUGCGUGGUGGCUCGAGGCGGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 141

 miR-6839 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6839 miRNA Mature ID miR-6839-3p

miRNA Sequence

 UUGGGUUUUCUCUUCAAUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 142

 miR-6847 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6847 miRNA Mature ID miR-6847-3p

miRNA Sequence

 GGCUCAUGUGUCUGUCCUCUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 143

 miR-6849 directly targets SLC1A5 [ 21 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

 ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 144

 miR-6852 directly targets SLC1A5 [ 23 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6852 miRNA Mature ID miR-6852-3p

miRNA Sequence

 UGUCCUCUGUUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 145

 miR-6856 directly targets SLC1A5 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6856 miRNA Mature ID miR-6856-3p

miRNA Sequence

 UACAGCCCUGUGAUCUUUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 146

 miR-6883 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6883 miRNA Mature ID miR-6883-5p

miRNA Sequence

 AGGGAGGGUGUGGUAUGGAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 147

 miR-6890 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6890 miRNA Mature ID miR-6890-3p

miRNA Sequence

 CCACUGCCUAUGCCCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 148

 miR-7106 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7106 miRNA Mature ID miR-7106-5p

miRNA Sequence

 UGGGAGGAGGGGAUCUUGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 149

 miR-7107 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7107 miRNA Mature ID miR-7107-5p

miRNA Sequence

 UCGGCCUGGGGAGGAGGAAGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 150

 miR-7151 directly targets SLC1A5 [ 19 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7151 miRNA Mature ID miR-7151-3p

miRNA Sequence

 CUACAGGCUGGAAUGGGCUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 151

 miR-744 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-744 miRNA Mature ID miR-744-3p

miRNA Sequence

 CUGUUGCCACUAACCUCAACCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 152

 miR-764 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-764 miRNA Mature ID miR-764

miRNA Sequence

 GCAGGUGCUCACUUGUCCUCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 153

 miR-7977 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

 UUCCCAGCCAACGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 154

 miR-8052 directly targets SLC1A5 [ 14 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8052 miRNA Mature ID miR-8052

miRNA Sequence

 CGGGACUGUAGAGGGCAUGAGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 155

 miR-8057 directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8057 miRNA Mature ID miR-8057

miRNA Sequence

 GUGGCUCUGUAGUAAGAUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 156

 miR-8064 directly targets SLC1A5 [ 24 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8064 miRNA Mature ID miR-8064

miRNA Sequence

 AGCACACUGAGCGAGCGGAC

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 157

 miR-8485 directly targets SLC1A5 [ 24 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 158

 miR-887 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-887 miRNA Mature ID miR-887-5p

miRNA Sequence

 CUUGGGAGCCCUGUUAGACUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 159

 miR-891a directly targets SLC1A5 [ 12 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-891a miRNA Mature ID miR-891a-3p

miRNA Sequence

 AGUGGCACAUGUUUGUUGUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 160

 miR-93 directly targets SLC1A5 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-93 miRNA Mature ID miR-93-5p

miRNA Sequence

 CAAAGUGCUGUUCGUGCAGGUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
7 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Epigenetic Activation of ASCT2 in the Hippocampus Contributes to Depression-Like Behavior by Regulating D-Serine in Mice. Front Mol Neurosci. 2017 May 9;10:139.
10 Genome-wide DNA methylation patterns in CD4+ T cells from Chinese Han patients with rheumatoid arthritis. Mod Rheumatol. 2017 May;27(3):441-447.
11 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
12 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
13 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
14 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
15 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
16 The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
17 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
18 Identification of miR-193b targets in breast cancer cells and systems biological analysis of their functional impact. Mol Cell Proteomics. 2011 Jul;10(7):M110.005322.
19 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
20 MicroRNA 218 acts as a tumor suppressor by targeting multiple cancer phenotype-associated genes in medulloblastoma. J Biol Chem. 2013 Jan 18;288(3):1918-28.
21 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
22 Genome-wide characterization of miR-34a induced changes in protein and mRNA expression by a combined pulsed SILAC and microarray analysis. Mol Cell Proteomics. 2011 Aug;10(8):M111.010462.
23 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
24 Argonaute CLIP Defines a Deregulated miR-122-Bound Transcriptome that Correlates with Patient Survival in Human Liver Cancer. Mol Cell. 2017 Aug 3;67(3):400-410.e7.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.