Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0134 Transporter Info
Gene Name SLC1A6
Transporter Name Excitatory amino acid transporter 4
Gene ID
6511
UniProt ID
P48664
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in hepatocellular carcinoma [ 1 ]

Location

 5'UTR (cg03784628)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.62E+00 Statistic Test p-value: 6.07E-10; Z-score: 2.18E+00

Methylation in Case

 1.98E-01 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in hepatocellular carcinoma [ 1 ]

Location

 TSS200 (cg12171675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.71E+00 Statistic Test p-value: 4.80E-06; Z-score: -1.34E+00

Methylation in Case

 5.06E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC1A6 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg18256640)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.66E+00 Statistic Test p-value: 7.49E-18; Z-score: -1.36E+01

Methylation in Case

 5.63E-01 (Median) Methylation in Control 9.35E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Bladder cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in bladder cancer [ 2 ]

Location

 TSS1500 (cg22175856)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.88E+00 Statistic Test p-value: 5.31E-09; Z-score: -6.89E+00

Methylation in Case

 4.42E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in bladder cancer [ 2 ]

Location

 TSS1500 (cg16377872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.85E-04; Z-score: -5.46E+00

Methylation in Case

 7.81E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC1A6 in bladder cancer [ 2 ]

Location

 TSS1500 (cg01007458)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 1.78E-02; Z-score: 4.42E+00

Methylation in Case

 5.49E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC1A6 in bladder cancer [ 2 ]

Location

 TSS200 (cg26494252)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 7.04E-04; Z-score: -1.90E+00

Methylation in Case

 5.56E-01 (Median) Methylation in Control 6.04E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC1A6 in bladder cancer [ 2 ]

Location

 TSS200 (cg11264635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.67E-03; Z-score: -4.49E+00

Methylation in Case

 5.56E-01 (Median) Methylation in Control 6.92E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC1A6 in bladder cancer [ 2 ]

Location

 TSS200 (cg16600501)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 9.70E-03; Z-score: -1.30E+00

Methylation in Case

 9.05E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC1A6 in bladder cancer [ 2 ]

Location

 Body (cg22198397)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 1.16E-06; Z-score: -9.45E+00

Methylation in Case

 6.33E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in breast cancer [ 3 ]

Location

 TSS1500 (cg01007458)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 7.58E-09; Z-score: 1.89E+00

Methylation in Case

 4.82E-01 (Median) Methylation in Control 3.62E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in breast cancer [ 3 ]

Location

 TSS1500 (cg16377872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 2.53E-07; Z-score: -2.22E+00

Methylation in Case

 6.69E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC1A6 in breast cancer [ 3 ]

Location

 TSS200 (cg26494252)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 7.32E-04; Z-score: -8.61E-01

Methylation in Case

 5.31E-01 (Median) Methylation in Control 5.69E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC1A6 in breast cancer [ 3 ]

Location

 Body (cg22198397)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.66E-06; Z-score: -1.75E+00

Methylation in Case

 5.96E-01 (Median) Methylation in Control 6.85E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg22175856)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.42E-04; Z-score: -2.15E+00

Methylation in Case

 9.13E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in colorectal cancer [ 4 ]

Location

 TSS1500 (cg16377872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.19E-04; Z-score: -8.48E-01

Methylation in Case

 8.80E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC1A6 in colorectal cancer [ 4 ]

Location

 TSS200 (cg11264635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 6.42E-06; Z-score: -1.24E+00

Methylation in Case

 7.83E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC1A6 in colorectal cancer [ 4 ]

Location

 TSS200 (cg26494252)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.15E-05; Z-score: -1.55E+00

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.55E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC1A6 in colorectal cancer [ 4 ]

Location

 TSS200 (cg16600501)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.12E-05; Z-score: -1.68E+00

Methylation in Case

 9.07E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC1A6 in colorectal cancer [ 4 ]

Location

 1stExon (cg06192619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 8.63E-03; Z-score: 1.34E-01

Methylation in Case

 9.52E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC1A6 in colorectal cancer [ 4 ]

Location

 1stExon (cg08901242)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.41E-02; Z-score: -3.20E-01

Methylation in Case

 8.88E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC1A6 in colorectal cancer [ 4 ]

Location

 Body (cg22198397)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 6.35E-07; Z-score: -2.72E+00

Methylation in Case

 8.65E-01 (Median) Methylation in Control 9.06E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in pancretic ductal adenocarcinoma [ 5 ]

Location

 TSS1500 (cg11288764)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.35E+00 Statistic Test p-value: 9.52E-12; Z-score: 1.77E+00

Methylation in Case

 2.56E-01 (Median) Methylation in Control 1.90E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in pancretic ductal adenocarcinoma [ 5 ]

Location

 Body (cg02552255)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 1.22E-19; Z-score: -3.25E+00

Methylation in Case

 5.00E-01 (Median) Methylation in Control 6.82E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC1A6 in pancretic ductal adenocarcinoma [ 5 ]

Location

 Body (cg13806356)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 3.75E-05; Z-score: -4.68E-01

Methylation in Case

 4.00E-01 (Median) Methylation in Control 4.26E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg16377872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.04E-05; Z-score: -9.06E-01

Methylation in Case

 8.70E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg22175856)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 6.10E-04; Z-score: -8.33E-01

Methylation in Case

 8.86E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC1A6 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg01007458)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 3.18E-02; Z-score: 1.35E+00

Methylation in Case

 7.00E-01 (Median) Methylation in Control 6.25E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC1A6 in papillary thyroid cancer [ 6 ]

Location

 TSS200 (cg11264635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.95E-05; Z-score: -8.22E-01

Methylation in Case

 6.92E-01 (Median) Methylation in Control 7.38E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC1A6 in papillary thyroid cancer [ 6 ]

Location

 TSS200 (cg16600501)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.76E-03; Z-score: -7.03E-01

Methylation in Case

 8.64E-01 (Median) Methylation in Control 8.79E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC1A6 in papillary thyroid cancer [ 6 ]

Location

 TSS200 (cg26494252)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 8.77E-03; Z-score: -5.44E-01

Methylation in Case

 5.27E-01 (Median) Methylation in Control 5.44E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC1A6 in papillary thyroid cancer [ 6 ]

Location

 1stExon (cg06192619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.22E-02; Z-score: -5.26E-01

Methylation in Case

 8.73E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC1A6 in papillary thyroid cancer [ 6 ]

Location

 Body (cg22198397)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.72E-04; Z-score: -8.13E-01

Methylation in Case

 7.87E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  HIV infection

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in HIV infection [ 7 ]

Location

 TSS200 (cg11264635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.52E-03; Z-score: -9.30E-01

Methylation in Case

 8.35E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in HIV infection [ 7 ]

Location

 TSS200 (cg16600501)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.12E-02; Z-score: -7.64E-01

Methylation in Case

 9.58E-01 (Median) Methylation in Control 9.69E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC1A6 in HIV infection [ 7 ]

Location

 1stExon (cg06192619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.13E-02; Z-score: 2.63E-01

Methylation in Case

 8.71E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in lung adenocarcinoma [ 8 ]

Location

 TSS200 (cg16600501)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.50E-02; Z-score: -1.43E+00

Methylation in Case

 8.70E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in lung adenocarcinoma [ 8 ]

Location

 Body (cg22198397)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 4.63E-03; Z-score: -2.64E+00

Methylation in Case

 7.68E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in systemic lupus erythematosus [ 9 ]

Location

 TSS200 (cg12171675)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.62E-02; Z-score: 3.41E-02

Methylation in Case

 8.88E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in systemic lupus erythematosus [ 9 ]

Location

 TSS200 (cg26494252)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 3.67E-02; Z-score: -3.87E-02

Methylation in Case

 6.85E-01 (Median) Methylation in Control 6.87E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC1A6 in systemic lupus erythematosus [ 9 ]

Location

 TSS200 (cg11264635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.60E-02; Z-score: -2.45E-01

Methylation in Case

 8.48E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC1A6 in systemic lupus erythematosus [ 9 ]

Location

 1stExon (cg08901242)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 3.19E-02; Z-score: -1.52E-01

Methylation in Case

 9.32E-01 (Median) Methylation in Control 9.35E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 1stExon (cg06192619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 2.05E-23; Z-score: -4.93E+00

Methylation in Case

 7.35E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC1A6 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 1stExon (cg08901242)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 9.10E-21; Z-score: -3.13E+00

Methylation in Case

 6.37E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC1A6 in prostate cancer [ 11 ]

Location

 1stExon (cg04098339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.37E+00 Statistic Test p-value: 3.89E-02; Z-score: 1.32E+00

Methylation in Case

 5.73E-01 (Median) Methylation in Control 4.19E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-26b directly targets SLC1A6 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.