Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0135 Transporter Info | ||||
| Gene Name | SLC1A7 | ||||
| Transporter Name | Excitatory amino acid transporter 5 | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Colon cancer |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
5'UTR (cg04779796) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 5.00E-05; Z-score: -2.47E+00 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 6.75E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS1500 (cg07590544) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.39E+00 | Statistic Test | p-value: 2.31E-03; Z-score: 1.46E+00 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 4.00E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
TSS200 (cg15360181) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.88E+00 | Statistic Test | p-value: 3.01E-05; Z-score: -2.74E+00 | ||
|
Methylation in Case |
2.25E-01 (Median) | Methylation in Control | 4.23E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
Body (cg02770054) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.61E+00 | Statistic Test | p-value: 1.16E-05; Z-score: 3.47E+00 | ||
|
Methylation in Case |
4.55E-01 (Median) | Methylation in Control | 2.82E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in colon adenocarcinoma | [ 1 ] | |||
|
Location |
3'UTR (cg05795390) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.94E-04; Z-score: -2.22E+00 | ||
|
Methylation in Case |
8.31E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg07212894) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 8.93E-06; Z-score: 1.43E-01 | ||
|
Methylation in Case |
6.01E-02 (Median) | Methylation in Control | 5.84E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg27150460) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.47E-08; Z-score: -1.54E+00 | ||
|
Methylation in Case |
2.83E-01 (Median) | Methylation in Control | 3.54E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg07488506) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.18E+00 | Statistic Test | p-value: 1.31E-04; Z-score: 1.08E+00 | ||
|
Methylation in Case |
7.64E-01 (Median) | Methylation in Control | 6.49E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg18799048) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 8.37E-04; Z-score: 2.64E-01 | ||
|
Methylation in Case |
5.74E-02 (Median) | Methylation in Control | 5.43E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
1stExon (cg05962092) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 2.07E-10; Z-score: 1.90E+00 | ||
|
Methylation in Case |
5.90E-01 (Median) | Methylation in Control | 4.06E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg01924561) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.36E+00 | Statistic Test | p-value: 6.94E-16; Z-score: -2.65E+00 | ||
|
Methylation in Case |
6.39E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg18793215) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 5.18E-14; Z-score: -2.80E+00 | ||
|
Methylation in Case |
3.44E-01 (Median) | Methylation in Control | 4.58E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg11827453) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 1.26E-12; Z-score: 2.19E+00 | ||
|
Methylation in Case |
4.29E-01 (Median) | Methylation in Control | 2.97E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg24756227) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.45E-05; Z-score: -1.08E+00 | ||
|
Methylation in Case |
3.19E-01 (Median) | Methylation in Control | 3.62E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg10801607) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.39E+00 | Statistic Test | p-value: 2.66E-02; Z-score: -6.94E-01 | ||
|
Methylation in Case |
1.41E-01 (Median) | Methylation in Control | 1.97E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg06885175) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.96E+00 | Statistic Test | p-value: 1.10E-09; Z-score: -2.02E+00 | ||
|
Methylation in Case |
2.06E-01 (Median) | Methylation in Control | 4.03E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A7 in pancretic ductal adenocarcinoma | [ 2 ] | |||
|
Location |
3'UTR (cg24141725) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.30E-03; Z-score: -3.36E-01 | ||
|
Methylation in Case |
9.39E-01 (Median) | Methylation in Control | 9.41E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in prostate cancer | [ 3 ] | |||
|
Location |
5'UTR (cg07766263) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.85E+00 | Statistic Test | p-value: 8.63E-03; Z-score: 4.28E+00 | ||
|
Methylation in Case |
6.05E-01 (Median) | Methylation in Control | 3.28E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in prostate cancer | [ 3 ] | |||
|
Location |
5'UTR (cg02227002) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.28E-02; Z-score: 6.57E+00 | ||
|
Methylation in Case |
9.31E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in prostate cancer | [ 3 ] | |||
|
Location |
5'UTR (cg11310629) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.19E+00 | Statistic Test | p-value: 4.90E-02; Z-score: 1.78E+00 | ||
|
Methylation in Case |
1.04E-01 (Median) | Methylation in Control | 8.74E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in prostate cancer | [ 3 ] | |||
|
Location |
TSS1500 (cg00114012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.36E-02; Z-score: -2.12E+00 | ||
|
Methylation in Case |
7.08E-01 (Median) | Methylation in Control | 7.87E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in prostate cancer | [ 3 ] | |||
|
Location |
Body (cg02253236) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 8.56E-03; Z-score: 2.56E+00 | ||
|
Methylation in Case |
8.85E-01 (Median) | Methylation in Control | 7.59E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in prostate cancer | [ 3 ] | |||
|
Location |
Body (cg10401356) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.53E-02; Z-score: -2.23E+00 | ||
|
Methylation in Case |
9.48E-01 (Median) | Methylation in Control | 9.74E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in prostate cancer | [ 3 ] | |||
|
Location |
Body (cg16061354) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 2.74E-02; Z-score: 1.66E+00 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.05E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in prostate cancer | [ 3 ] | |||
|
Location |
Body (cg22999540) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.38E+00 | Statistic Test | p-value: 2.77E-02; Z-score: -1.47E+00 | ||
|
Methylation in Case |
1.69E-01 (Median) | Methylation in Control | 2.33E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
18 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg07793724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 2.45E-04; Z-score: -3.19E+00 | ||
|
Methylation in Case |
5.25E-01 (Median) | Methylation in Control | 6.66E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
TSS1500 (cg08037774) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 6.27E-03; Z-score: -1.90E+00 | ||
|
Methylation in Case |
8.02E-01 (Median) | Methylation in Control | 8.39E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
TSS200 (cg18046365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 3.62E-03; Z-score: -5.45E+00 | ||
|
Methylation in Case |
4.66E-01 (Median) | Methylation in Control | 5.65E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
1stExon (cg19196684) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 1.82E-04; Z-score: -3.36E+00 | ||
|
Methylation in Case |
6.49E-01 (Median) | Methylation in Control | 7.35E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg00317626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 1.29E-10; Z-score: 1.92E+01 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 5.40E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01132471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 1.62E-08; Z-score: -6.44E+00 | ||
|
Methylation in Case |
4.08E-01 (Median) | Methylation in Control | 6.29E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg05414613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 3.60E-08; Z-score: -8.95E+00 | ||
|
Methylation in Case |
5.67E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg08121408) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.29E+00 | Statistic Test | p-value: 4.25E-07; Z-score: -8.67E+00 | ||
|
Methylation in Case |
6.10E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg25762078) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 2.26E-06; Z-score: -1.39E+01 | ||
|
Methylation in Case |
7.02E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg01808968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.78E+00 | Statistic Test | p-value: 3.52E-06; Z-score: -5.84E+00 | ||
|
Methylation in Case |
1.68E-01 (Median) | Methylation in Control | 4.67E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg05802073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 8.06E-05; Z-score: -4.21E+00 | ||
|
Methylation in Case |
2.68E-01 (Median) | Methylation in Control | 4.10E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg25381331) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.06E-03; Z-score: -3.58E+00 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.32E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg14212966) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 1.31E-03; Z-score: -2.69E+00 | ||
|
Methylation in Case |
6.44E-01 (Median) | Methylation in Control | 7.95E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg26060003) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.74E-03; Z-score: -2.32E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg24497686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.52E-03; Z-score: -1.50E+00 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg04142017) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 5.32E-03; Z-score: -4.17E+00 | ||
|
Methylation in Case |
9.41E-01 (Median) | Methylation in Control | 9.72E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
Body (cg03511974) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.52E-02; Z-score: -7.32E-01 | ||
|
Methylation in Case |
9.35E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A7 in bladder cancer | [ 4 ] | |||
|
Location |
3'UTR (cg16167013) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 8.52E-03; Z-score: -2.06E+00 | ||
|
Methylation in Case |
8.41E-01 (Median) | Methylation in Control | 8.72E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg08037774) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 4.42E-08; Z-score: -1.62E+00 | ||
|
Methylation in Case |
7.61E-01 (Median) | Methylation in Control | 8.14E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
TSS200 (cg18046365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 1.33E-10; Z-score: -2.09E+00 | ||
|
Methylation in Case |
4.25E-01 (Median) | Methylation in Control | 6.00E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
1stExon (cg19196684) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 3.76E-15; Z-score: -3.05E+00 | ||
|
Methylation in Case |
6.63E-01 (Median) | Methylation in Control | 7.52E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg14212966) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 4.51E-15; Z-score: -2.45E+00 | ||
|
Methylation in Case |
6.02E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg25762078) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 4.80E-13; Z-score: -2.56E+00 | ||
|
Methylation in Case |
7.54E-01 (Median) | Methylation in Control | 8.47E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg00317626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 2.93E-12; Z-score: 3.04E+00 | ||
|
Methylation in Case |
6.54E-01 (Median) | Methylation in Control | 4.80E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg22398359) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 4.42E-10; Z-score: -2.25E+00 | ||
|
Methylation in Case |
7.34E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg05414613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 5.18E-10; Z-score: -2.10E+00 | ||
|
Methylation in Case |
6.75E-01 (Median) | Methylation in Control | 7.59E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg10529401) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 4.56E-07; Z-score: 1.38E+00 | ||
|
Methylation in Case |
5.04E-01 (Median) | Methylation in Control | 4.56E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg00532936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 8.60E-07; Z-score: 1.38E+00 | ||
|
Methylation in Case |
5.19E-01 (Median) | Methylation in Control | 4.21E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg04142017) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.85E-06; Z-score: -1.33E+00 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.61E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg26060003) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 4.78E-06; Z-score: -1.48E+00 | ||
|
Methylation in Case |
7.03E-01 (Median) | Methylation in Control | 7.97E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg15526153) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 8.19E-06; Z-score: -8.92E-01 | ||
|
Methylation in Case |
7.76E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg20741386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 2.26E-05; Z-score: -1.02E+00 | ||
|
Methylation in Case |
7.48E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01808968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 3.41E-04; Z-score: -1.24E+00 | ||
|
Methylation in Case |
3.83E-01 (Median) | Methylation in Control | 4.71E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg16395366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 8.37E-04; Z-score: -1.02E-01 | ||
|
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg03511974) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.62E-03; Z-score: -6.21E-01 | ||
|
Methylation in Case |
9.10E-01 (Median) | Methylation in Control | 9.39E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg27315239) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.69E-03; Z-score: -5.16E-01 | ||
|
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 8.93E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC1A7 in breast cancer | [ 5 ] | |||
|
Location |
Body (cg01823958) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 7.23E-03; Z-score: -5.71E-01 | ||
|
Methylation in Case |
5.60E-01 (Median) | Methylation in Control | 6.02E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
22 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg08037774) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.25E-08; Z-score: -2.50E+00 | ||
|
Methylation in Case |
8.54E-01 (Median) | Methylation in Control | 9.07E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg07793724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.32E-03; Z-score: -6.71E-01 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.42E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
TSS200 (cg18046365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 8.38E-10; Z-score: -2.49E+00 | ||
|
Methylation in Case |
5.96E-01 (Median) | Methylation in Control | 7.17E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg05414613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 1.98E-13; Z-score: -4.38E+00 | ||
|
Methylation in Case |
8.15E-01 (Median) | Methylation in Control | 8.99E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg01132471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 5.09E-13; Z-score: -3.76E+00 | ||
|
Methylation in Case |
7.04E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg24497686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 2.06E-08; Z-score: -2.25E+00 | ||
|
Methylation in Case |
7.88E-01 (Median) | Methylation in Control | 8.61E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg26060003) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.39E-07; Z-score: -1.97E+00 | ||
|
Methylation in Case |
7.87E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg25381331) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.97E-07; Z-score: -1.75E+00 | ||
|
Methylation in Case |
9.42E-01 (Median) | Methylation in Control | 9.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg25762078) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 6.28E-07; Z-score: -4.28E+00 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 9.02E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg14212966) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 7.28E-07; Z-score: -1.55E+00 | ||
|
Methylation in Case |
8.49E-01 (Median) | Methylation in Control | 8.83E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg15526153) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.71E-06; Z-score: -1.33E+00 | ||
|
Methylation in Case |
9.07E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg10529401) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 7.09E-06; Z-score: -1.18E+00 | ||
|
Methylation in Case |
7.51E-01 (Median) | Methylation in Control | 8.09E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg16395366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 7.94E-06; Z-score: -1.63E+00 | ||
|
Methylation in Case |
9.31E-01 (Median) | Methylation in Control | 9.58E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg02155655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.65E-05; Z-score: -6.90E-01 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg20741386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.06E-05; Z-score: -2.37E+00 | ||
|
Methylation in Case |
8.99E-01 (Median) | Methylation in Control | 9.24E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg01823958) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 4.27E-04; Z-score: -9.78E-01 | ||
|
Methylation in Case |
8.38E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg08121408) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.75E-03; Z-score: -4.18E-01 | ||
|
Methylation in Case |
8.36E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg04142017) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 5.23E-03; Z-score: -4.78E-02 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg03511974) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 6.97E-03; Z-score: -5.81E-01 | ||
|
Methylation in Case |
9.66E-01 (Median) | Methylation in Control | 9.69E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg22398359) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.15E-02; Z-score: -4.82E-01 | ||
|
Methylation in Case |
9.32E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC1A7 in colorectal cancer | [ 6 ] | |||
|
Location |
Body (cg00532936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 1.94E-02; Z-score: -5.41E-01 | ||
|
Methylation in Case |
7.69E-01 (Median) | Methylation in Control | 8.21E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Depression |
4 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in depression | [ 7 ] | |||
|
Location |
TSS1500 (cg07793724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 3.90E-02; Z-score: 5.37E-01 | ||
|
Methylation in Case |
5.57E-01 (Median) | Methylation in Control | 4.89E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in depression | [ 7 ] | |||
|
Location |
Body (cg00317626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.49E-02; Z-score: -4.57E-01 | ||
|
Methylation in Case |
8.44E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in depression | [ 7 ] | |||
|
Location |
Body (cg16395366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.75E-02; Z-score: -3.13E-01 | ||
|
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in depression | [ 7 ] | |||
|
Location |
Body (cg05802073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.80E-02; Z-score: -1.32E-01 | ||
|
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 7.40E-01 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
26 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg20963030) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.66E+00 | Statistic Test | p-value: 4.01E-12; Z-score: -3.29E+00 | ||
|
Methylation in Case |
3.64E-01 (Median) | Methylation in Control | 6.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg18046365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.58E-05; Z-score: -9.49E-01 | ||
|
Methylation in Case |
5.75E-01 (Median) | Methylation in Control | 6.39E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
1stExon (cg06192619) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 2.24E-16; Z-score: -1.26E+01 | ||
|
Methylation in Case |
5.81E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
1stExon (cg19196684) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.86E-03; Z-score: -5.94E-01 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 7.36E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg02009040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 2.70E-15; Z-score: -1.49E+01 | ||
|
Methylation in Case |
5.65E-01 (Median) | Methylation in Control | 8.19E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg06805940) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 1.06E-14; Z-score: -5.20E+00 | ||
|
Methylation in Case |
5.44E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg08420415) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.79E+00 | Statistic Test | p-value: 1.74E-11; Z-score: 4.74E+00 | ||
|
Methylation in Case |
2.82E-01 (Median) | Methylation in Control | 1.58E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg02034204) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 7.59E-10; Z-score: -2.50E+00 | ||
|
Methylation in Case |
8.17E-01 (Median) | Methylation in Control | 8.68E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg03511974) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 5.50E-07; Z-score: -9.58E-01 | ||
|
Methylation in Case |
9.38E-01 (Median) | Methylation in Control | 9.59E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg10529401) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.08E-06; Z-score: -1.09E+00 | ||
|
Methylation in Case |
5.85E-01 (Median) | Methylation in Control | 6.32E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg15526153) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.53E-06; Z-score: -1.07E+00 | ||
|
Methylation in Case |
8.12E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg01808968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 5.00E-06; Z-score: -1.11E+00 | ||
|
Methylation in Case |
5.92E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg09134876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.34E-05; Z-score: -9.12E-01 | ||
|
Methylation in Case |
7.40E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg22398359) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 7.31E-05; Z-score: -3.36E-01 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 8.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg05414613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.48E-03; Z-score: -9.13E-01 | ||
|
Methylation in Case |
7.83E-01 (Median) | Methylation in Control | 8.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg09551072) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 2.06E-03; Z-score: -7.19E-01 | ||
|
Methylation in Case |
8.20E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg04142017) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 2.24E-03; Z-score: -1.10E-01 | ||
|
Methylation in Case |
9.51E-01 (Median) | Methylation in Control | 9.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg08121408) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 3.91E-03; Z-score: -4.76E-01 | ||
|
Methylation in Case |
5.74E-01 (Median) | Methylation in Control | 6.20E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg05802073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 5.72E-03; Z-score: -6.57E-01 | ||
|
Methylation in Case |
4.83E-01 (Median) | Methylation in Control | 5.44E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg01132471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 6.44E-03; Z-score: -2.15E-01 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 7.50E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg26060003) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 9.90E-03; Z-score: -5.40E-01 | ||
|
Methylation in Case |
8.37E-01 (Median) | Methylation in Control | 8.51E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg24497686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.02E-02; Z-score: -2.46E-01 | ||
|
Methylation in Case |
7.97E-01 (Median) | Methylation in Control | 8.10E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg00317626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.34E-02; Z-score: -3.93E-01 | ||
|
Methylation in Case |
6.79E-01 (Median) | Methylation in Control | 7.02E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 24 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg20326410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.05E-02; Z-score: -2.37E-01 | ||
|
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 7.59E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 25 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
Body (cg16395366) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 3.04E-02; Z-score: -7.96E-02 | ||
|
Methylation in Case |
9.24E-01 (Median) | Methylation in Control | 9.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 26 |
Methylation of SLC1A7 in hepatocellular carcinoma | [ 8 ] | |||
|
Location |
3'UTR (cg03234405) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.48E+00 | Statistic Test | p-value: 6.80E-13; Z-score: -3.44E+00 | ||
|
Methylation in Case |
5.37E-01 (Median) | Methylation in Control | 7.93E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
HIV infection |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
TSS1500 (cg07793724) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 7.10E-05; Z-score: 9.00E-01 | ||
|
Methylation in Case |
7.41E-01 (Median) | Methylation in Control | 6.11E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
TSS1500 (cg08037774) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 3.20E-04; Z-score: -1.54E+00 | ||
|
Methylation in Case |
8.79E-01 (Median) | Methylation in Control | 9.08E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
TSS200 (cg18046365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.57E-06; Z-score: -1.64E+00 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 6.87E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg01823958) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 3.03E-06; Z-score: 2.26E+00 | ||
|
Methylation in Case |
5.53E-01 (Median) | Methylation in Control | 3.84E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg26060003) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 4.81E-06; Z-score: 2.11E+00 | ||
|
Methylation in Case |
7.67E-01 (Median) | Methylation in Control | 6.91E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg05414613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 7.19E-06; Z-score: 1.98E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 7.08E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg10529401) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 5.88E-05; Z-score: -1.89E+00 | ||
|
Methylation in Case |
6.67E-01 (Median) | Methylation in Control | 7.39E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg24497686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 6.99E-05; Z-score: -1.80E+00 | ||
|
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 9.11E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg01808968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 9.85E-04; Z-score: -1.44E+00 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.22E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg00317626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.16E-03; Z-score: 9.58E-01 | ||
|
Methylation in Case |
9.46E-01 (Median) | Methylation in Control | 9.29E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg25762078) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.39E-03; Z-score: -1.47E+00 | ||
|
Methylation in Case |
8.55E-01 (Median) | Methylation in Control | 8.86E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg22398359) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 4.44E-03; Z-score: 8.66E-01 | ||
|
Methylation in Case |
8.73E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg14212966) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 6.70E-03; Z-score: 1.35E+00 | ||
|
Methylation in Case |
7.27E-01 (Median) | Methylation in Control | 6.49E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg00532936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.85E-02; Z-score: 7.60E-01 | ||
|
Methylation in Case |
7.73E-01 (Median) | Methylation in Control | 7.46E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg09551072) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.78E-02; Z-score: -7.32E-01 | ||
|
Methylation in Case |
8.70E-01 (Median) | Methylation in Control | 8.85E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A7 in HIV infection | [ 9 ] | |||
|
Location |
Body (cg05802073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 3.72E-02; Z-score: 4.35E-01 | ||
|
Methylation in Case |
7.75E-01 (Median) | Methylation in Control | 7.59E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
TSS1500 (cg08037774) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 3.04E-02; Z-score: -1.44E+00 | ||
|
Methylation in Case |
8.37E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg24497686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.78E-05; Z-score: -2.79E+00 | ||
|
Methylation in Case |
8.01E-01 (Median) | Methylation in Control | 8.54E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg00317626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.21E+00 | Statistic Test | p-value: 6.94E-03; Z-score: 1.97E+00 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 6.71E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg01808968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 9.83E-03; Z-score: -1.48E+00 | ||
|
Methylation in Case |
5.93E-01 (Median) | Methylation in Control | 6.76E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg00532936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 1.18E-02; Z-score: -1.79E+00 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 6.75E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg10529401) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.06E-02; Z-score: -1.52E+00 | ||
|
Methylation in Case |
6.24E-01 (Median) | Methylation in Control | 6.74E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg25762078) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 2.57E-02; Z-score: -1.32E+00 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.55E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in lung adenocarcinoma | [ 10 ] | |||
|
Location |
Body (cg02155655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.61E-02; Z-score: -5.93E-01 | ||
|
Methylation in Case |
8.06E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
7 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in panic disorder | [ 11 ] | |||
|
Location |
TSS1500 (cg08037774) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 4.10E-02; Z-score: 4.91E-01 | ||
|
Methylation in Case |
3.35E+00 (Median) | Methylation in Control | 3.17E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in panic disorder | [ 11 ] | |||
|
Location |
Body (cg24497686) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 8.06E-05; Z-score: 7.26E-01 | ||
|
Methylation in Case |
2.35E+00 (Median) | Methylation in Control | 2.13E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in panic disorder | [ 11 ] | |||
|
Location |
Body (cg10529401) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 6.84E-03; Z-score: 4.82E-01 | ||
|
Methylation in Case |
1.38E+00 (Median) | Methylation in Control | 1.21E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in panic disorder | [ 11 ] | |||
|
Location |
Body (cg08121408) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 7.99E-03; Z-score: 3.93E-01 | ||
|
Methylation in Case |
2.60E+00 (Median) | Methylation in Control | 2.27E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in panic disorder | [ 11 ] | |||
|
Location |
Body (cg01132471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.21E-02; Z-score: 7.45E-01 | ||
|
Methylation in Case |
2.42E+00 (Median) | Methylation in Control | 1.95E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in panic disorder | [ 11 ] | |||
|
Location |
Body (cg00532936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 2.66E-02; Z-score: 3.21E-01 | ||
|
Methylation in Case |
1.49E+00 (Median) | Methylation in Control | 1.33E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in panic disorder | [ 11 ] | |||
|
Location |
Body (cg05802073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 3.54E-02; Z-score: 5.30E-01 | ||
|
Methylation in Case |
2.05E+00 (Median) | Methylation in Control | 1.86E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
18 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
TSS200 (cg18046365) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 2.78E-04; Z-score: -6.16E-01 | ||
|
Methylation in Case |
4.00E-01 (Median) | Methylation in Control | 4.41E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg00532936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.37E+00 | Statistic Test | p-value: 1.57E-16; Z-score: -3.89E+00 | ||
|
Methylation in Case |
5.51E-01 (Median) | Methylation in Control | 7.55E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg01823958) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 9.44E-08; Z-score: -1.47E+00 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.45E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg14212966) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.14E-05; Z-score: -8.26E-01 | ||
|
Methylation in Case |
8.51E-01 (Median) | Methylation in Control | 8.75E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg00317626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.17E+00 | Statistic Test | p-value: 2.29E-05; Z-score: 1.30E+00 | ||
|
Methylation in Case |
6.69E-01 (Median) | Methylation in Control | 5.70E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg05414613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.57E-05; Z-score: -9.58E-01 | ||
|
Methylation in Case |
8.63E-01 (Median) | Methylation in Control | 8.82E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg10529401) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 2.94E-05; Z-score: 2.16E+00 | ||
|
Methylation in Case |
6.92E-01 (Median) | Methylation in Control | 6.06E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg20326410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.14E+00 | Statistic Test | p-value: 1.10E-04; Z-score: 1.52E+00 | ||
|
Methylation in Case |
7.92E-01 (Median) | Methylation in Control | 6.97E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg09551072) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.24E-02; Z-score: -6.54E-01 | ||
|
Methylation in Case |
9.08E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg25762078) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.31E-02; Z-score: -6.79E-01 | ||
|
Methylation in Case |
9.06E-01 (Median) | Methylation in Control | 9.21E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg01132471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.34E-02; Z-score: 1.49E+00 | ||
|
Methylation in Case |
7.29E-01 (Median) | Methylation in Control | 6.47E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg04142017) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.58E-02; Z-score: -5.46E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.42E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg26060003) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.64E-02; Z-score: -5.03E-01 | ||
|
Methylation in Case |
7.77E-01 (Median) | Methylation in Control | 7.88E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg22398359) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.00E+00 | Statistic Test | p-value: 1.70E-02; Z-score: 2.21E-02 | ||
|
Methylation in Case |
8.77E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg01808968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 2.00E-02; Z-score: -1.14E+00 | ||
|
Methylation in Case |
6.68E-01 (Median) | Methylation in Control | 7.26E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg03511974) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.02E-02; Z-score: 5.91E-01 | ||
|
Methylation in Case |
8.94E-01 (Median) | Methylation in Control | 8.77E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg15526153) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 2.05E-02; Z-score: 1.45E+00 | ||
|
Methylation in Case |
8.65E-01 (Median) | Methylation in Control | 8.13E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC1A7 in papillary thyroid cancer | [ 12 ] | |||
|
Location |
Body (cg20741386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 3.70E-02; Z-score: 3.70E-01 | ||
|
Methylation in Case |
8.64E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
17 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
1stExon (cg19196684) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.83E+00 | Statistic Test | p-value: 1.10E-17; Z-score: 2.85E+00 | ||
|
Methylation in Case |
7.46E-01 (Median) | Methylation in Control | 4.07E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg00317626) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 2.18E-05; Z-score: -8.47E-01 | ||
|
Methylation in Case |
6.27E-01 (Median) | Methylation in Control | 7.05E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg00532936) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.84E-05; Z-score: -1.06E+00 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 8.23E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg01132471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 4.68E-05; Z-score: -1.29E+00 | ||
|
Methylation in Case |
1.29E-01 (Median) | Methylation in Control | 1.98E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg01808968) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.02E+00 | Statistic Test | p-value: 8.53E-05; Z-score: -1.09E+00 | ||
|
Methylation in Case |
3.89E-02 (Median) | Methylation in Control | 7.86E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg01823958) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 8.84E-05; Z-score: 9.22E-01 | ||
|
Methylation in Case |
9.00E-01 (Median) | Methylation in Control | 8.70E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg02155655) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.20E-04; Z-score: -6.76E-01 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 8.50E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg03511974) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.44E+00 | Statistic Test | p-value: 3.64E-04; Z-score: 1.13E+00 | ||
|
Methylation in Case |
5.09E-01 (Median) | Methylation in Control | 3.53E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg04142017) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 5.65E-04; Z-score: 8.62E-01 | ||
|
Methylation in Case |
8.13E-01 (Median) | Methylation in Control | 7.64E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg05414613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.56E+00 | Statistic Test | p-value: 1.46E-03; Z-score: -4.69E-01 | ||
|
Methylation in Case |
1.48E-01 (Median) | Methylation in Control | 2.32E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg05802073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 1.65E-03; Z-score: 8.84E-01 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 3.77E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg08121408) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 5.34E-03; Z-score: 3.78E-01 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 7.72E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg09134876) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 9.29E-03; Z-score: 3.79E-01 | ||
|
Methylation in Case |
8.80E-01 (Median) | Methylation in Control | 8.18E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg09551072) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.10E-02; Z-score: -4.78E-01 | ||
|
Methylation in Case |
7.91E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg10529401) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.36E+00 | Statistic Test | p-value: 1.50E-02; Z-score: 6.79E-01 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 1.12E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
Body (cg14212966) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.74E+00 | Statistic Test | p-value: 4.29E-02; Z-score: -5.78E-01 | ||
|
Methylation in Case |
3.33E-02 (Median) | Methylation in Control | 5.80E-02 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC1A7 in atypical teratoid rhabdoid tumor | [ 13 ] | |||
|
Location |
3'UTR (cg16167013) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 8.33E-11; Z-score: -1.74E+00 | ||
|
Methylation in Case |
8.21E-01 (Median) | Methylation in Control | 9.16E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg05414613) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 1.84E-05; Z-score: -1.44E+00 | ||
|
Methylation in Case |
8.90E-01 (Median) | Methylation in Control | 9.17E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg01823958) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 9.72E-05; Z-score: -1.51E+00 | ||
|
Methylation in Case |
8.24E-01 (Median) | Methylation in Control | 8.69E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg22398359) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.75E-04; Z-score: -1.75E+00 | ||
|
Methylation in Case |
9.52E-01 (Median) | Methylation in Control | 9.67E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg26060003) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 2.27E-03; Z-score: -4.58E-01 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 8.44E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in clear cell renal cell carcinoma | [ 14 ] | |||
|
Location |
Body (cg14212966) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.58E-02; Z-score: -5.88E-01 | ||
|
Methylation in Case |
8.83E-01 (Median) | Methylation in Control | 8.96E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC1A7 in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg05802073) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.14E-03; Z-score: -4.43E-01 | ||
|
Methylation in Case |
7.37E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC1A7 in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg22398359) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.92E-02; Z-score: -2.71E-01 | ||
|
Methylation in Case |
8.88E-01 (Median) | Methylation in Control | 8.98E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC1A7 in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg01132471) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.21E-02; Z-score: -1.33E-01 | ||
|
Methylation in Case |
8.52E-01 (Median) | Methylation in Control | 8.58E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC1A7 in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg20326410) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.40E-02; Z-score: -2.19E-01 | ||
|
Methylation in Case |
8.59E-01 (Median) | Methylation in Control | 8.67E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC1A7 in systemic lupus erythematosus | [ 15 ] | |||
|
Location |
Body (cg27315239) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.92E-02; Z-score: -2.84E-02 | ||
|
Methylation in Case |
9.34E-01 (Median) | Methylation in Control | 9.35E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC1A7 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.70E-07; Fold-change: -0.649764837; Z-score: -9.590838399 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Esthesioneuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC1A7 in esthesioneuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Esthesioneuroblastoma [ICD-11:2D50.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.25E-26; Fold-change: -0.635869735; Z-score: -9.293148562 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Medulloblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC1A7 in medulloblastoma than that in healthy individual | ||||
Studied Phenotype |
Medulloblastoma [ICD-11:2A00.10] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 4.08E-61; Fold-change: -0.597484016; Z-score: -3.610414794 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
microRNA |
|||||
|
Unclear Phenotype |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-221 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-221 | miRNA Mature ID | miR-221-5p | ||
|
miRNA Sequence |
ACCUGGCAUACAAUGUAGAUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 2 |
miR-3064 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3064 | miRNA Mature ID | miR-3064-5p | ||
|
miRNA Sequence |
UCUGGCUGUUGUGGUGUGCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 3 |
miR-4660 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4660 | miRNA Mature ID | miR-4660 | ||
|
miRNA Sequence |
UGCAGCUCUGGUGGAAAAUGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 4 |
miR-4793 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4793 | miRNA Mature ID | miR-4793-5p | ||
|
miRNA Sequence |
ACAUCCUGCUCCACAGGGCAGAGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 5 |
miR-604 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-604 | miRNA Mature ID | miR-604 | ||
|
miRNA Sequence |
AGGCUGCGGAAUUCAGGAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 6 |
miR-647 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-647 | miRNA Mature ID | miR-647 | ||
|
miRNA Sequence |
GUGGCUGCACUCACUUCCUUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 7 |
miR-6501 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6501 | miRNA Mature ID | miR-6501-3p | ||
|
miRNA Sequence |
CCAGAGCAGCCUGCGGUAACAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 8 |
miR-6504 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6504 | miRNA Mature ID | miR-6504-5p | ||
|
miRNA Sequence |
UCUGGCUGUGCUGUAAUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 9 |
miR-6736 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6736 | miRNA Mature ID | miR-6736-3p | ||
|
miRNA Sequence |
UCAGCUCCUCUCUACCCACAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 10 |
miR-6762 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6762 | miRNA Mature ID | miR-6762-3p | ||
|
miRNA Sequence |
UGGCUGCUUCCCUUGGUCUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 11 |
miR-8073 directly targets SLC1A7 | [ 16 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-8073 | miRNA Mature ID | miR-8073 | ||
|
miRNA Sequence |
ACCUGGCAGCAGGGAGCGUCGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.