Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0136 Transporter Info
Gene Name SLC20A1
Transporter Name Sodium-dependent phosphate transporter 1
Gene ID
6574
UniProt ID
Q8WUM9
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg20366258)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 4.08E-06; Z-score: 9.82E-01

Methylation in Case

 8.56E-01 (Median) Methylation in Control 7.42E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 2.24E-03; Z-score: 6.28E-01

Methylation in Case

 9.06E-02 (Median) Methylation in Control 7.94E-02 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg07986907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.51E+00 Statistic Test p-value: 5.21E-03; Z-score: -1.14E+00

Methylation in Case

 1.20E-01 (Median) Methylation in Control 1.82E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg10552282)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.50E-02; Z-score: 1.02E-01

Methylation in Case

 1.10E-01 (Median) Methylation in Control 1.08E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg10898730)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.89E-02; Z-score: 5.18E-01

Methylation in Case

 5.41E-01 (Median) Methylation in Control 4.71E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC20A1 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg19599386)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 2.83E-10; Z-score: -1.90E+00

Methylation in Case

 5.23E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in colon adenocarcinoma [ 2 ]

Location

 5'UTR (cg20277159)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 1.00E-04; Z-score: -1.91E+00

Methylation in Case

 5.26E-01 (Median) Methylation in Control 6.46E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in colon adenocarcinoma [ 2 ]

Location

 TSS200 (cg00319692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.22E-05; Z-score: -4.11E+00

Methylation in Case

 5.85E-01 (Median) Methylation in Control 7.45E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in colon adenocarcinoma [ 2 ]

Location

 Body (cg09760889)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 2.20E-06; Z-score: -3.71E+00

Methylation in Case

 5.66E-01 (Median) Methylation in Control 7.23E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in colon adenocarcinoma [ 2 ]

Location

 Body (cg02471153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 4.22E-06; Z-score: 1.35E+00

Methylation in Case

 5.72E-01 (Median) Methylation in Control 4.86E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in colon adenocarcinoma [ 2 ]

Location

 Body (cg25429150)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 8.11E-05; Z-score: -3.85E+00

Methylation in Case

 6.84E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC20A1 in colon adenocarcinoma [ 2 ]

Location

 Body (cg02738641)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 7.77E-04; Z-score: -1.46E+00

Methylation in Case

 7.33E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

 5'UTR (cg03236570)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 2.57E-04; Z-score: -8.49E-01

Methylation in Case

 6.15E-02 (Median) Methylation in Control 6.94E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

 5'UTR (cg14630985)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 4.31E-02; Z-score: -4.89E-01

Methylation in Case

 9.10E-02 (Median) Methylation in Control 9.77E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

 TSS1500 (cg00649606)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 6.70E-23; Z-score: -3.64E+00

Methylation in Case

 3.18E-01 (Median) Methylation in Control 3.81E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

 TSS1500 (cg09459719)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 2.28E-03; Z-score: -6.37E-01

Methylation in Case

 9.99E-02 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

 TSS1500 (cg16437134)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 1.62E-02; Z-score: 1.02E+00

Methylation in Case

 6.00E-01 (Median) Methylation in Control 5.00E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC20A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

 Body (cg14212966)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.07E-03; Z-score: -4.40E-01

Methylation in Case

 7.47E-01 (Median) Methylation in Control 7.72E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC20A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

 Body (cg21532061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 2.09E-02; Z-score: 8.39E-01

Methylation in Case

 8.54E-01 (Median) Methylation in Control 8.05E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC20A1 in pancretic ductal adenocarcinoma [ 3 ]

Location

 Body (cg16363447)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.44E-02; Z-score: 5.82E-01

Methylation in Case

 9.37E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 TSS1500 (cg05672265)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 4.35E-06; Z-score: -5.55E+00

Methylation in Case

 7.75E-02 (Median) Methylation in Control 9.17E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 TSS1500 (cg05422897)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 2.53E-03; Z-score: -2.68E+00

Methylation in Case

 9.23E-02 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 TSS1500 (cg01081561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 4.55E-03; Z-score: -2.63E+00

Methylation in Case

 6.14E-02 (Median) Methylation in Control 8.39E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 TSS1500 (cg02109766)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.66E-02; Z-score: -1.73E+00

Methylation in Case

 3.42E-02 (Median) Methylation in Control 4.38E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 TSS1500 (cg23886783)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 3.70E-02; Z-score: -1.15E+00

Methylation in Case

 7.90E-02 (Median) Methylation in Control 9.43E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.46E+00 Statistic Test p-value: 2.66E-11; Z-score: -1.20E+01

Methylation in Case

 1.93E-01 (Median) Methylation in Control 4.75E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 Body (cg26703507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.28E+00 Statistic Test p-value: 4.87E-09; Z-score: -8.37E+00

Methylation in Case

 1.74E-01 (Median) Methylation in Control 5.72E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 Body (cg10898730)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.70E+00 Statistic Test p-value: 4.38E-04; Z-score: -3.05E+00

Methylation in Case

 4.52E-02 (Median) Methylation in Control 7.66E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 Body (cg10552282)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 5.67E-04; Z-score: -5.50E+00

Methylation in Case

 8.25E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 Body (cg07986907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 3.25E-03; Z-score: -2.67E+00

Methylation in Case

 6.75E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC20A1 in bladder cancer [ 4 ]

Location

 3'UTR (cg19599386)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 1.35E-02; Z-score: -1.95E+00

Methylation in Case

 5.10E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 TSS1500 (cg01081561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 3.99E-08; Z-score: -9.90E-01

Methylation in Case

 7.11E-02 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 TSS1500 (cg05672265)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.01E-02; Z-score: -4.45E-01

Methylation in Case

 6.82E-02 (Median) Methylation in Control 7.70E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 TSS1500 (cg05422897)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 3.78E-02; Z-score: -4.06E-01

Methylation in Case

 6.80E-02 (Median) Methylation in Control 7.75E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 TSS1500 (cg02109766)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 4.36E-02; Z-score: -5.20E-01

Methylation in Case

 3.72E-02 (Median) Methylation in Control 4.42E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 TSS200 (cg18169187)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 2.33E-03; Z-score: 4.98E-01

Methylation in Case

 2.59E-02 (Median) Methylation in Control 2.18E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.67E+00 Statistic Test p-value: 2.23E-21; Z-score: -3.34E+00

Methylation in Case

 2.66E-01 (Median) Methylation in Control 4.43E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 Body (cg26703507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.85E+00 Statistic Test p-value: 6.27E-16; Z-score: -2.69E+00

Methylation in Case

 2.69E-01 (Median) Methylation in Control 4.98E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 Body (cg10898730)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 4.52E-09; Z-score: -1.22E+00

Methylation in Case

 4.54E-02 (Median) Methylation in Control 6.92E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 Body (cg07986907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.50E-07; Z-score: -1.76E+00

Methylation in Case

 7.54E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC20A1 in breast cancer [ 5 ]

Location

 3'UTR (cg19599386)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.07E-02; Z-score: -4.59E-01

Methylation in Case

 6.14E-01 (Median) Methylation in Control 6.46E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS1500 (cg01081561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.61E+00 Statistic Test p-value: 5.22E-06; Z-score: 2.00E+00

Methylation in Case

 6.57E-02 (Median) Methylation in Control 4.08E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS1500 (cg02109766)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 2.06E-05; Z-score: 1.19E+00

Methylation in Case

 1.58E-02 (Median) Methylation in Control 1.24E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in clear cell renal cell carcinoma [ 6 ]

Location

 TSS1500 (cg05672265)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 4.90E-03; Z-score: 4.15E-01

Methylation in Case

 3.48E-02 (Median) Methylation in Control 3.19E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in clear cell renal cell carcinoma [ 6 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 2.01E-06; Z-score: -1.88E+00

Methylation in Case

 4.98E-01 (Median) Methylation in Control 6.32E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in clear cell renal cell carcinoma [ 6 ]

Location

 Body (cg10898730)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.79E+00 Statistic Test p-value: 3.39E-04; Z-score: -2.79E+00

Methylation in Case

 3.68E-02 (Median) Methylation in Control 1.03E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC20A1 in clear cell renal cell carcinoma [ 6 ]

Location

 Body (cg26703507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 4.25E-04; Z-score: -8.38E-01

Methylation in Case

 6.60E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg03902905)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.96E-12; Z-score: -1.62E+00

Methylation in Case

 7.01E-01 (Median) Methylation in Control 7.61E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg05672265)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 3.34E-02; Z-score: -5.28E-01

Methylation in Case

 6.25E-02 (Median) Methylation in Control 6.60E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg20439022)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 4.25E-13; Z-score: 3.52E+00

Methylation in Case

 5.39E-01 (Median) Methylation in Control 4.11E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg26703507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 1.92E-09; Z-score: -2.22E+00

Methylation in Case

 4.43E-01 (Median) Methylation in Control 6.01E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg10898730)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.65E+00 Statistic Test p-value: 3.97E-07; Z-score: -1.81E+00

Methylation in Case

 7.75E-02 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC20A1 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 8.25E-07; Z-score: -1.76E+00

Methylation in Case

 3.89E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in HIV infection [ 8 ]

Location

 TSS1500 (cg01081561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 1.72E-03; Z-score: 1.37E+00

Methylation in Case

 7.03E-02 (Median) Methylation in Control 5.62E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in HIV infection [ 8 ]

Location

 TSS1500 (cg05672265)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.51E-02; Z-score: -2.64E-01

Methylation in Case

 7.50E-02 (Median) Methylation in Control 7.80E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in HIV infection [ 8 ]

Location

 Body (cg07986907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 3.70E-16; Z-score: 2.72E+00

Methylation in Case

 9.00E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in HIV infection [ 8 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.46E+00 Statistic Test p-value: 1.48E-11; Z-score: -2.03E+00

Methylation in Case

 2.62E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in HIV infection [ 8 ]

Location

 Body (cg26703507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 6.80E-10; Z-score: -1.96E+00

Methylation in Case

 3.87E-01 (Median) Methylation in Control 5.29E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC20A1 in HIV infection [ 8 ]

Location

 3'UTR (cg19599386)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 3.76E-14; Z-score: 2.69E+00

Methylation in Case

 6.68E-01 (Median) Methylation in Control 5.09E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg01081561)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 8.35E-08; Z-score: -2.01E+00

Methylation in Case

 1.55E-01 (Median) Methylation in Control 2.37E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg05672265)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 3.82E-04; Z-score: -5.17E-01

Methylation in Case

 6.12E-02 (Median) Methylation in Control 6.52E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg02109766)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 4.57E-03; Z-score: -1.00E+00

Methylation in Case

 5.49E-02 (Median) Methylation in Control 7.18E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg05422897)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.83E-02; Z-score: -1.08E-01

Methylation in Case

 3.89E-02 (Median) Methylation in Control 3.97E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in papillary thyroid cancer [ 9 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 2.27E-05; Z-score: -1.04E+00

Methylation in Case

 6.31E-01 (Median) Methylation in Control 7.01E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in prostate cancer [ 10 ]

Location

 TSS1500 (cg26519141)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.72E+00 Statistic Test p-value: 3.33E-03; Z-score: -4.33E+00

Methylation in Case

 1.07E-01 (Median) Methylation in Control 1.83E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in prostate cancer [ 10 ]

Location

 Body (cg00374672)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.71E+00 Statistic Test p-value: 7.70E-03; Z-score: 6.52E+00

Methylation in Case

 6.04E-01 (Median) Methylation in Control 3.53E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in prostate cancer [ 10 ]

Location

 Body (cg01977413)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.51E+00 Statistic Test p-value: 3.69E-02; Z-score: -2.88E+00

Methylation in Case

 3.41E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in prostate cancer [ 10 ]

Location

 Body (cg11677852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.83E-02; Z-score: 1.57E+00

Methylation in Case

 9.20E-01 (Median) Methylation in Control 8.81E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in systemic lupus erythematosus [ 11 ]

Location

 TSS1500 (cg05422897)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 6.44E-04; Z-score: -2.21E-01

Methylation in Case

 8.76E-02 (Median) Methylation in Control 9.15E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in systemic lupus erythematosus [ 11 ]

Location

 TSS1500 (cg05672265)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.41E-02; Z-score: -1.43E-01

Methylation in Case

 9.07E-02 (Median) Methylation in Control 9.29E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in systemic lupus erythematosus [ 11 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.41E-02; Z-score: -2.83E-01

Methylation in Case

 3.25E-01 (Median) Methylation in Control 3.61E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in systemic lupus erythematosus [ 11 ]

Location

 3'UTR (cg19599386)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.78E-02; Z-score: 8.29E-02

Methylation in Case

 7.46E-01 (Median) Methylation in Control 7.38E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in depression [ 12 ]

Location

 TSS200 (cg18169187)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.96E-02; Z-score: -2.55E-01

Methylation in Case

 4.16E-02 (Median) Methylation in Control 4.34E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in colorectal cancer [ 13 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.35E+00 Statistic Test p-value: 2.42E-11; Z-score: -2.52E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 7.21E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in colorectal cancer [ 13 ]

Location

 Body (cg26703507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 1.10E-10; Z-score: -2.52E+00

Methylation in Case

 6.22E-01 (Median) Methylation in Control 8.04E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in colorectal cancer [ 13 ]

Location

 Body (cg10898730)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 8.42E-04; Z-score: -1.38E+00

Methylation in Case

 9.91E-02 (Median) Methylation in Control 1.33E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in colorectal cancer [ 13 ]

Location

 Body (cg07986907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.40E-03; Z-score: -5.58E-01

Methylation in Case

 9.27E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC20A1 in colorectal cancer [ 13 ]

Location

 3'UTR (cg19599386)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 3.35E-03; Z-score: -1.13E+00

Methylation in Case

 7.70E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in lung adenocarcinoma [ 14 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 7.77E-04; Z-score: -1.89E+00

Methylation in Case

 3.85E-01 (Median) Methylation in Control 4.86E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in lung adenocarcinoma [ 14 ]

Location

 Body (cg26703507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.38E+00 Statistic Test p-value: 8.40E-04; Z-score: -2.45E+00

Methylation in Case

 4.18E-01 (Median) Methylation in Control 5.78E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in lung adenocarcinoma [ 14 ]

Location

 Body (cg07986907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.96E-02; Z-score: 1.10E+00

Methylation in Case

 8.72E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC20A1 in lung adenocarcinoma [ 14 ]

Location

 Body (cg10898730)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 2.38E-02; Z-score: -1.30E+00

Methylation in Case

 9.81E-02 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC20A1 in panic disorder [ 15 ]

Location

 Body (cg07986907)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 4.29E-04; Z-score: -6.76E-01

Methylation in Case

 1.79E+00 (Median) Methylation in Control 2.06E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC20A1 in panic disorder [ 15 ]

Location

 Body (cg26703507)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.88E+00 Statistic Test p-value: 1.58E-02; Z-score: 4.47E-01

Methylation in Case

 2.94E-01 (Median) Methylation in Control 6.02E-02 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC20A1 in panic disorder [ 15 ]

Location

 Body (cg06121808)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 8.93E-01 Statistic Test p-value: 3.53E-02; Z-score: 2.78E-01

Methylation in Case

 -9.24E-01 (Median) Methylation in Control -1.04E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          24 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7a directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7a miRNA Mature ID let-7a-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 let-7b directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 let-7c directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7c miRNA Mature ID let-7c-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 let-7d directly targets SLC20A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7d miRNA Mature ID let-7d-5p

miRNA Sequence

 AGAGGUAGUAGGUUGCAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 let-7e directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7e miRNA Mature ID let-7e-5p

miRNA Sequence

 UGAGGUAGGAGGUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 let-7f directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7f miRNA Mature ID let-7f-5p

miRNA Sequence

 UGAGGUAGUAGAUUGUAUAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 let-7g directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7g miRNA Mature ID let-7g-5p

miRNA Sequence

 UGAGGUAGUAGUUUGUACAGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 let-7i directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7i miRNA Mature ID let-7i-5p

miRNA Sequence

 UGAGGUAGUAGUUUGUGCUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-196a directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method Sequencing

miRNA Stemloop ID

 miR-196a miRNA Mature ID miR-196a-5p

miRNA Sequence

 UAGGUAGUUUCAUGUUGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-3202 directly targets SLC20A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3202 miRNA Mature ID miR-3202

miRNA Sequence

 UGGAAGGGAGAAGAGCUUUAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-3529 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3529 miRNA Mature ID miR-3529-5p

miRNA Sequence

 AGGUAGACUGGGAUUUGUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-3646 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3646 miRNA Mature ID miR-3646

miRNA Sequence

 AAAAUGAAAUGAGCCCAGCCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-379 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-379 miRNA Mature ID miR-379-5p

miRNA Sequence

 UGGUAGACUAUGGAACGUAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-3927 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3927 miRNA Mature ID miR-3927-3p

miRNA Sequence

 CAGGUAGAUAUUUGAUAGGCAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-4458 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4458 miRNA Mature ID miR-4458

miRNA Sequence

 AGAGGUAGGUGUGGAAGAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-4500 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4500 miRNA Mature ID miR-4500

miRNA Sequence

 UGAGGUAGUAGUUUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-4533 directly targets SLC20A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4533 miRNA Mature ID miR-4533

miRNA Sequence

 UGGAAGGAGGUUGCCGGACGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-4802 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4802 miRNA Mature ID miR-4802-3p

miRNA Sequence

 UACAUGGAUGGAAACCUUCAAGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 19

 miR-506 directly targets SLC20A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-506 miRNA Mature ID miR-506-5p

miRNA Sequence

 UAUUCAGGAAGGUGUUACUUAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-6831 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6831 miRNA Mature ID miR-6831-5p

miRNA Sequence

 UAGGUAGAGUGUGAGGAGGAGGUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 21

 miR-892c directly targets SLC20A1 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-892c miRNA Mature ID miR-892c-5p

miRNA Sequence

 UAUUCAGAAAGGUGCCAGUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-92a directly targets SLC20A1 [ 18 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

 UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 23

 miR-935 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-935 miRNA Mature ID miR-935

miRNA Sequence

 CCAGUUACCGCUUCCGCUACCGC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-98 directly targets SLC20A1 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
3 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
4 DNA Methylation Dynamics in Urological Tumors.
5 Genome-wide Scan for Methylation Profiles in Breast Cancer
6 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
14 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
15 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
16 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
17 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
18 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.