Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0142 Transporter Info
Gene Name SLC22A16
Transporter Name Fly-like putative transporter 2
Gene ID
85413
UniProt ID
Q86VW1
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg06731865)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.53E-04; Z-score: -1.63E+00

Methylation in Case

 7.77E-01 (Median) Methylation in Control 8.16E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in colon adenocarcinoma [ 1 ]

Location

 Body (cg13537353)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 5.60E-05; Z-score: 1.58E+00

Methylation in Case

 6.10E-01 (Median) Methylation in Control 4.79E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in colon adenocarcinoma [ 1 ]

Location

 Body (cg10577586)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.39E-04; Z-score: -2.19E+00

Methylation in Case

 6.24E-01 (Median) Methylation in Control 6.99E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in colon adenocarcinoma [ 1 ]

Location

 Body (cg10626169)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 2.25E-04; Z-score: -1.54E+00

Methylation in Case

 5.48E-01 (Median) Methylation in Control 6.27E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A16 in colon adenocarcinoma [ 1 ]

Location

 Body (cg08829393)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.13E-04; Z-score: -1.57E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A16 in colon adenocarcinoma [ 1 ]

Location

 Body (cg10954740)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 3.75E-04; Z-score: -2.71E+00

Methylation in Case

 5.23E-01 (Median) Methylation in Control 6.86E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in pancretic ductal adenocarcinoma [ 2 ]

Location

 5'UTR (cg17306814)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 5.45E-03; Z-score: 1.17E+00

Methylation in Case

 8.56E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS1500 (cg25313204)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 9.01E-04; Z-score: -7.88E-01

Methylation in Case

 5.36E-01 (Median) Methylation in Control 6.51E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg09130091)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.23E-08; Z-score: 1.38E+00

Methylation in Case

 5.21E-01 (Median) Methylation in Control 4.91E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg02675946)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.13E+00 Statistic Test p-value: 3.14E-05; Z-score: -1.74E+00

Methylation in Case

 1.40E-01 (Median) Methylation in Control 2.98E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A16 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg01295188)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 7.59E-04; Z-score: 6.31E-01

Methylation in Case

 7.55E-01 (Median) Methylation in Control 6.99E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A16 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg27428304)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.70E+00 Statistic Test p-value: 1.35E-03; Z-score: -1.64E+00

Methylation in Case

 9.94E-02 (Median) Methylation in Control 2.68E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A16 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg02557110)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.28E-02; Z-score: 2.29E-01

Methylation in Case

 8.58E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in bladder cancer [ 3 ]

Location

 TSS1500 (cg11605355)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 6.35E-04; Z-score: 5.54E+00

Methylation in Case

 8.90E-01 (Median) Methylation in Control 7.82E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in bladder cancer [ 3 ]

Location

 TSS1500 (cg18521925)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.78E-02; Z-score: -7.38E-01

Methylation in Case

 7.79E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in bladder cancer [ 3 ]

Location

 TSS1500 (cg24926253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 3.47E-02; Z-score: -1.34E+00

Methylation in Case

 8.08E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in bladder cancer [ 3 ]

Location

 TSS200 (cg19980771)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.87E+00 Statistic Test p-value: 7.20E-06; Z-score: 5.91E+00

Methylation in Case

 6.57E-01 (Median) Methylation in Control 1.70E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A16 in bladder cancer [ 3 ]

Location

 TSS200 (cg12929486)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.57E+00 Statistic Test p-value: 1.57E-05; Z-score: 4.62E+00

Methylation in Case

 2.53E-01 (Median) Methylation in Control 9.85E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A16 in bladder cancer [ 3 ]

Location

 Body (cg23210852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.22E+00 Statistic Test p-value: 5.74E-07; Z-score: 2.16E+01

Methylation in Case

 4.59E-01 (Median) Methylation in Control 1.09E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A16 in bladder cancer [ 3 ]

Location

 Body (cg04014105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.50E+00 Statistic Test p-value: 1.04E-06; Z-score: 1.58E+01

Methylation in Case

 4.60E-01 (Median) Methylation in Control 1.02E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC22A16 in bladder cancer [ 3 ]

Location

 Body (cg22334665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.81E+00 Statistic Test p-value: 1.90E-06; Z-score: 2.34E+01

Methylation in Case

 3.30E-01 (Median) Methylation in Control 8.67E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC22A16 in bladder cancer [ 3 ]

Location

 Body (cg13665414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 1.30E-03; Z-score: -2.65E+00

Methylation in Case

 3.57E-01 (Median) Methylation in Control 4.32E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 TSS1500 (cg11605355)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 6.76E-04; Z-score: 7.92E-01

Methylation in Case

 8.37E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 TSS1500 (cg18521925)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 7.32E-03; Z-score: -6.71E-01

Methylation in Case

 7.69E-01 (Median) Methylation in Control 7.97E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 TSS1500 (cg22607760)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.85E-02; Z-score: 6.42E-01

Methylation in Case

 8.80E-01 (Median) Methylation in Control 8.51E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 TSS200 (cg19980771)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.34E+00 Statistic Test p-value: 3.37E-13; Z-score: 3.77E+00

Methylation in Case

 4.03E-01 (Median) Methylation in Control 1.72E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 TSS200 (cg12929486)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.68E+00 Statistic Test p-value: 1.81E-05; Z-score: 1.04E+00

Methylation in Case

 1.38E-01 (Median) Methylation in Control 8.22E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 Body (cg22334665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.29E+00 Statistic Test p-value: 2.77E-11; Z-score: 3.95E+00

Methylation in Case

 1.76E-01 (Median) Methylation in Control 7.68E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 Body (cg04014105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.10E+00 Statistic Test p-value: 1.01E-10; Z-score: 3.40E+00

Methylation in Case

 1.70E-01 (Median) Methylation in Control 8.08E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 Body (cg23210852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.73E+00 Statistic Test p-value: 1.27E-09; Z-score: 2.85E+00

Methylation in Case

 1.56E-01 (Median) Methylation in Control 9.01E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 Body (cg13665414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 4.18E-03; Z-score: -1.19E+00

Methylation in Case

 3.77E-01 (Median) Methylation in Control 4.53E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 Body (cg26197117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 5.03E-03; Z-score: 1.62E-01

Methylation in Case

 1.26E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC22A16 in breast cancer [ 4 ]

Location

 Body (cg10616767)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.65E-02; Z-score: -7.25E-01

Methylation in Case

 8.58E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg24926253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.09E-03; Z-score: -7.78E-01

Methylation in Case

 8.85E-01 (Median) Methylation in Control 9.05E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg22607760)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.40E-02; Z-score: 7.62E-01

Methylation in Case

 9.37E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 TSS200 (cg19980771)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.76E+00 Statistic Test p-value: 1.05E-06; Z-score: 1.72E+00

Methylation in Case

 8.14E-01 (Median) Methylation in Control 4.61E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 TSS200 (cg12929486)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.62E+00 Statistic Test p-value: 7.70E-06; Z-score: 1.05E+00

Methylation in Case

 4.19E-01 (Median) Methylation in Control 2.58E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 Body (cg13665414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.36E+00 Statistic Test p-value: 2.69E-10; Z-score: -2.14E+00

Methylation in Case

 4.27E-01 (Median) Methylation in Control 5.81E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 Body (cg23210852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.67E+00 Statistic Test p-value: 1.78E-08; Z-score: 1.82E+00

Methylation in Case

 6.51E-01 (Median) Methylation in Control 3.90E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 Body (cg04014105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.04E+00 Statistic Test p-value: 4.44E-08; Z-score: 1.85E+00

Methylation in Case

 5.71E-01 (Median) Methylation in Control 2.80E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 Body (cg22334665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.61E+00 Statistic Test p-value: 1.65E-06; Z-score: 1.50E+00

Methylation in Case

 5.79E-01 (Median) Methylation in Control 3.59E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 Body (cg26197117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 1.86E-03; Z-score: 9.77E-01

Methylation in Case

 5.69E-01 (Median) Methylation in Control 4.74E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC22A16 in colorectal cancer [ 5 ]

Location

 Body (cg10616767)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.89E-02; Z-score: -5.66E-01

Methylation in Case

 9.43E-01 (Median) Methylation in Control 9.46E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg18521925)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.15E-05; Z-score: -1.96E+00

Methylation in Case

 7.79E-01 (Median) Methylation in Control 8.14E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg24926253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.03E-04; Z-score: -4.00E-01

Methylation in Case

 8.25E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg12929486)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.47E+00 Statistic Test p-value: 1.09E-05; Z-score: 7.96E-01

Methylation in Case

 3.56E-01 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg05916255)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 1.02E-17; Z-score: -4.30E+00

Methylation in Case

 7.42E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A16 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg09674468)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.65E+00 Statistic Test p-value: 3.92E-17; Z-score: -2.74E+00

Methylation in Case

 2.48E-01 (Median) Methylation in Control 4.09E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A16 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg19426594)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 2.61E-15; Z-score: -2.39E+00

Methylation in Case

 5.19E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A16 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg13825334)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 2.36E-13; Z-score: -1.40E+01

Methylation in Case

 6.37E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC22A16 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg26197117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 4.84E-03; Z-score: 1.30E+00

Methylation in Case

 4.26E-01 (Median) Methylation in Control 3.34E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC22A16 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg13665414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.41E-02; Z-score: -6.49E-01

Methylation in Case

 3.49E-01 (Median) Methylation in Control 3.92E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg22607760)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.02E-02; Z-score: 6.87E-01

Methylation in Case

 9.21E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in papillary thyroid cancer [ 7 ]

Location

 Body (cg04014105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 2.75E-04; Z-score: 6.33E-01

Methylation in Case

 1.21E-01 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in papillary thyroid cancer [ 7 ]

Location

 Body (cg23210852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 6.64E-03; Z-score: 3.31E-01

Methylation in Case

 9.28E-02 (Median) Methylation in Control 8.70E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in clear cell renal cell carcinoma [ 8 ]

Location

 TSS200 (cg19980771)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.45E+00 Statistic Test p-value: 1.37E-03; Z-score: 5.60E-01

Methylation in Case

 1.27E-01 (Median) Methylation in Control 8.74E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg13665414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 1.90E-04; Z-score: -1.59E+00

Methylation in Case

 5.16E-01 (Median) Methylation in Control 5.99E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg04014105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 6.60E-04; Z-score: 4.86E-01

Methylation in Case

 9.31E-02 (Median) Methylation in Control 8.05E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg23210852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.21E-03; Z-score: 8.48E-02

Methylation in Case

 1.08E-01 (Median) Methylation in Control 1.05E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A16 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg22334665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.74E-03; Z-score: 4.29E-01

Methylation in Case

 1.04E-01 (Median) Methylation in Control 8.87E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A16 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg26197117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.74E+00 Statistic Test p-value: 2.10E-03; Z-score: -1.84E+00

Methylation in Case

 1.92E-01 (Median) Methylation in Control 3.34E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  HIV infection

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in HIV infection [ 9 ]

Location

 TSS200 (cg19980771)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 3.41E-02; Z-score: 6.56E-01

Methylation in Case

 3.71E-01 (Median) Methylation in Control 2.89E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in HIV infection [ 9 ]

Location

 Body (cg13665414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 1.15E-04; Z-score: 1.56E+00

Methylation in Case

 9.20E-02 (Median) Methylation in Control 7.10E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in HIV infection [ 9 ]

Location

 Body (cg04014105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.54E+00 Statistic Test p-value: 1.57E-04; Z-score: 1.83E+00

Methylation in Case

 8.81E-02 (Median) Methylation in Control 5.71E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in HIV infection [ 9 ]

Location

 Body (cg22334665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.30E+00 Statistic Test p-value: 1.09E-03; Z-score: 9.96E-01

Methylation in Case

 7.83E-02 (Median) Methylation in Control 6.02E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A16 in HIV infection [ 9 ]

Location

 Body (cg23210852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.44E+00 Statistic Test p-value: 1.79E-03; Z-score: 1.25E+00

Methylation in Case

 8.62E-02 (Median) Methylation in Control 5.99E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A16 in HIV infection [ 9 ]

Location

 Body (cg26197117)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.40E+00 Statistic Test p-value: 2.40E-03; Z-score: 1.34E+00

Methylation in Case

 6.76E-02 (Median) Methylation in Control 4.83E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A16 in HIV infection [ 9 ]

Location

 Body (cg10616767)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.61E-02; Z-score: -5.16E-01

Methylation in Case

 9.27E-01 (Median) Methylation in Control 9.36E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in lung adenocarcinoma [ 10 ]

Location

 TSS200 (cg19980771)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.69E+00 Statistic Test p-value: 5.96E-03; Z-score: 2.00E+00

Methylation in Case

 5.38E-01 (Median) Methylation in Control 3.19E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in lung adenocarcinoma [ 10 ]

Location

 Body (cg22334665)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.29E+00 Statistic Test p-value: 4.80E-03; Z-score: 1.28E+01

Methylation in Case

 2.89E-01 (Median) Methylation in Control 1.26E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in lung adenocarcinoma [ 10 ]

Location

 Body (cg04014105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.23E+00 Statistic Test p-value: 9.72E-03; Z-score: 1.50E+01

Methylation in Case

 2.69E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in lung adenocarcinoma [ 10 ]

Location

 Body (cg23210852)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.90E+00 Statistic Test p-value: 1.80E-02; Z-score: 9.84E+00

Methylation in Case

 2.44E-01 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in prostate cancer [ 11 ]

Location

 TSS200 (cg26215887)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 2.30E-02; Z-score: 2.56E+00

Methylation in Case

 7.22E-02 (Median) Methylation in Control 5.77E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in prostate cancer [ 11 ]

Location

 Body (cg02672229)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.25E-02; Z-score: 7.28E+00

Methylation in Case

 9.32E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in prostate cancer [ 11 ]

Location

 Body (cg21334510)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.98E-02; Z-score: -2.64E+00

Methylation in Case

 4.32E-01 (Median) Methylation in Control 5.51E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A16 in prostate cancer [ 11 ]

Location

 Body (cg16241391)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 3.05E-02; Z-score: -3.38E+00

Methylation in Case

 6.72E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg04014105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 5.24E-04; Z-score: -1.14E+00

Methylation in Case

 8.66E-01 (Median) Methylation in Control 9.09E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A16 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg10616767)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.66E-02; Z-score: 6.55E-01

Methylation in Case

 9.06E-01 (Median) Methylation in Control 8.75E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A16 in atypical teratoid rhabdoid tumor [ 12 ]

Location

 Body (cg13665414)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 3.78E-02; Z-score: 5.36E-01

Methylation in Case

 4.04E-01 (Median) Methylation in Control 3.36E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A16 in systemic lupus erythematosus [ 13 ]

Location

 Body (cg04014105)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.97E-02; Z-score: 2.70E-02

Methylation in Case

 6.55E-02 (Median) Methylation in Control 6.50E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Gastric cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate/significant/moderate hypermethylation of SLC22A16 in gastric cancer disease than that in healthy individual/adjacent tissue/other disease section

Studied Phenotype

 Gastric cancer [ICD-11:2B72]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 3.83E-27; Fold-change: 0.267439225; Z-score: 2.265762915

The Methylation Level of Disease Section Compare with the Adjacent Tissue

 p-value: 3.33E-59; Fold-change: 0.348241622; Z-score: 74.26918302
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual

  Liver cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant/significant hypermethylation of SLC22A16 in liver cancer than that in healthy individual/adjacent tissue

Studied Phenotype

 Liver cancer [ICD-11:2C12]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 6.29E-05; Fold-change: 0.414174728; Z-score: 1.200750533

The Methylation Level of Disease Section Compare with the Adjacent Tissue

 p-value: 1.41E-11; Fold-change: 0.320491867; Z-score: 2.663132007
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
DT methylation level in tissue other than the diseased tissue of patients
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual
Download DT methylation data in the tissue of the other disease section

  Malignant astrocytoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypermethylation of SLC22A16 in malignant astrocytoma than that in healthy individual

Studied Phenotype

 Malignant astrocytoma [ICD-11:2A00.12]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 7.41E-17; Fold-change: 0.239954267; Z-score: 1.160602918
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Oligodendroglioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypermethylation of SLC22A16 in oligodendroglioma than that in healthy individual

Studied Phenotype

 Oligodendroglioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 3.88E-06; Fold-change: 0.240636033; Z-score: 0.931788198
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Acute myeloid leukemia

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC22A16 in acute myeloid leukemia than that in healthy individual

Studied Phenotype

 Acute myeloid leukemia [ICD-11:2A60]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.24E-05; Fold-change: -0.259021751; Z-score: -0.884391789
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Glioblastoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC22A16 in glioblastoma than that in healthy individual

Studied Phenotype

 Glioblastoma [ICD-11:2A00.00]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.039421725; Fold-change: 0.322957869; Z-score: 0.952188812
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Lymphoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC22A16 in lymphoma than that in healthy individual

Studied Phenotype

 Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 2.53E-22; Fold-change: 0.551485645; Z-score: 2.135456641
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-335 directly targets SLC22A16 [ 14 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
9 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
10 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
13 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.