Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0146 Transporter Info
Gene Name	SLC22A23
Transporter Name	Solute carrier family 22 member 23
Gene ID	63027
UniProt ID	A1A5C7

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in bladder cancer			[ 1 ]
Location	TSS1500 (cg01585293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.45E+00	Statistic Test	p-value: 1.58E-04; Z-score: -4.17E+00
Methylation in Case	1.04E-01 (Median)	Methylation in Control	1.51E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in bladder cancer			[ 1 ]
Location	TSS1500 (cg04883742)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 7.38E-03; Z-score: -2.19E+00
Methylation in Case	2.26E-02 (Median)	Methylation in Control	3.40E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in bladder cancer			[ 1 ]
Location	1stExon (cg06662991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 4.62E-02; Z-score: -1.56E+00
Methylation in Case	9.70E-02 (Median)	Methylation in Control	1.27E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in bladder cancer			[ 1 ]
Location	Body (cg10091752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.72E+00	Statistic Test	p-value: 1.99E-10; Z-score: -8.82E+00
Methylation in Case	1.58E-01 (Median)	Methylation in Control	4.32E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in bladder cancer			[ 1 ]
Location	Body (cg13318241)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.27E+00	Statistic Test	p-value: 4.96E-10; Z-score: -8.36E+00
Methylation in Case	2.81E-01 (Median)	Methylation in Control	6.39E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A23 in bladder cancer			[ 1 ]
Location	Body (cg16984553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 1.16E-03; Z-score: -2.95E+00
Methylation in Case	6.45E-02 (Median)	Methylation in Control	8.68E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A23 in bladder cancer			[ 1 ]
Location	Body (cg01163597)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 1.94E-03; Z-score: -2.86E+00
Methylation in Case	9.72E-02 (Median)	Methylation in Control	1.27E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A23 in bladder cancer			[ 1 ]
Location	Body (cg15032604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.34E-02; Z-score: -1.39E+00
Methylation in Case	8.23E-01 (Median)	Methylation in Control	8.36E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in breast cancer			[ 2 ]
Location	TSS1500 (cg11713788)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.21E+00	Statistic Test	p-value: 2.14E-17; Z-score: -2.06E+00
Methylation in Case	1.81E-01 (Median)	Methylation in Control	4.01E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in breast cancer			[ 2 ]
Location	TSS1500 (cg05989628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 8.83E-07; Z-score: -1.02E+00
Methylation in Case	4.40E-02 (Median)	Methylation in Control	6.17E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in breast cancer			[ 2 ]
Location	TSS1500 (cg14527280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 4.47E-04; Z-score: -6.06E-01
Methylation in Case	6.87E-02 (Median)	Methylation in Control	9.67E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in breast cancer			[ 2 ]
Location	Body (cg15032604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.88E-07; Z-score: -1.24E+00
Methylation in Case	8.17E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in breast cancer			[ 2 ]
Location	Body (cg01163597)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 2.16E-03; Z-score: 9.14E-01
Methylation in Case	1.46E-01 (Median)	Methylation in Control	1.26E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A23 in breast cancer			[ 2 ]
Location	Body (cg16984553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 1.07E-02; Z-score: 3.19E-01
Methylation in Case	7.82E-02 (Median)	Methylation in Control	7.11E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A23 in breast cancer			[ 2 ]
Location	Body (cg10091752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 1.54E-02; Z-score: -1.22E+00
Methylation in Case	3.69E-01 (Median)	Methylation in Control	4.27E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A23 in breast cancer			[ 2 ]
Location	Body (cg13318241)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.61E-02; Z-score: -8.97E-01
Methylation in Case	6.09E-01 (Median)	Methylation in Control	6.53E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg01585293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.34E+00	Statistic Test	p-value: 1.67E-04; Z-score: 1.25E+00
Methylation in Case	1.00E-01 (Median)	Methylation in Control	7.49E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg14527280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 2.97E-02; Z-score: 1.05E+00
Methylation in Case	4.28E-02 (Median)	Methylation in Control	3.65E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in clear cell renal cell carcinoma			[ 3 ]
Location	1stExon (cg04086786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.55E-05; Z-score: 1.11E+00
Methylation in Case	3.25E-02 (Median)	Methylation in Control	2.91E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in clear cell renal cell carcinoma			[ 3 ]
Location	1stExon (cg06662991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 9.50E-03; Z-score: 4.89E-01
Methylation in Case	4.61E-02 (Median)	Methylation in Control	4.16E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg01163597)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 8.97E-05; Z-score: 1.12E+00
Methylation in Case	1.04E-01 (Median)	Methylation in Control	7.63E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A23 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg16984553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 2.83E-03; Z-score: 8.99E-01
Methylation in Case	4.66E-02 (Median)	Methylation in Control	3.54E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in colon adenocarcinoma			[ 4 ]
Location	TSS1500 (cg06895831)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 4.61E-04; Z-score: -1.59E+00
Methylation in Case	4.99E-01 (Median)	Methylation in Control	5.98E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in colon adenocarcinoma			[ 4 ]
Location	1stExon (cg17263061)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.68E+00	Statistic Test	p-value: 2.95E-05; Z-score: 4.30E+00
Methylation in Case	3.77E-01 (Median)	Methylation in Control	1.03E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in colon adenocarcinoma			[ 4 ]
Location	Body (cg22792910)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 9.64E-06; Z-score: -1.68E+00
Methylation in Case	2.95E-01 (Median)	Methylation in Control	4.10E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in colon adenocarcinoma			[ 4 ]
Location	Body (cg04204452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 4.72E-05; Z-score: -2.74E+00
Methylation in Case	6.43E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in colon adenocarcinoma			[ 4 ]
Location	Body (cg11287443)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 4.32E-03; Z-score: -9.22E-01
Methylation in Case	7.79E-01 (Median)	Methylation in Control	8.05E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A23 in colon adenocarcinoma			[ 4 ]
Location	3'UTR (cg17442852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.44E-03; Z-score: -2.16E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Colorectal cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg01585293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 7.47E-10; Z-score: -1.79E+00
Methylation in Case	1.12E-01 (Median)	Methylation in Control	1.49E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg14527280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 2.96E-02; Z-score: -6.73E-01
Methylation in Case	7.17E-02 (Median)	Methylation in Control	8.25E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg04883742)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 3.06E-02; Z-score: 6.11E-02
Methylation in Case	1.42E-02 (Median)	Methylation in Control	1.39E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in colorectal cancer			[ 5 ]
Location	Body (cg16984553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 1.25E-03; Z-score: -9.32E-01
Methylation in Case	1.08E-01 (Median)	Methylation in Control	1.32E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in colorectal cancer			[ 5 ]
Location	Body (cg01163597)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 3.00E-02; Z-score: -7.01E-01
Methylation in Case	1.71E-01 (Median)	Methylation in Control	1.93E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
HIV infection	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in HIV infection			[ 6 ]
Location	TSS1500 (cg14527280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.36E+00	Statistic Test	p-value: 2.22E-05; Z-score: 1.34E+00
Methylation in Case	5.24E-02 (Median)	Methylation in Control	3.85E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in HIV infection			[ 6 ]
Location	TSS1500 (cg01585293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 9.34E-05; Z-score: 1.17E+00
Methylation in Case	1.08E-01 (Median)	Methylation in Control	8.86E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in HIV infection			[ 6 ]
Location	1stExon (cg04086786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 6.05E-03; Z-score: 4.86E-01
Methylation in Case	4.42E-02 (Median)	Methylation in Control	3.94E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in HIV infection			[ 6 ]
Location	Body (cg01163597)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.40E+00	Statistic Test	p-value: 1.80E-06; Z-score: 2.07E+00
Methylation in Case	1.70E-01 (Median)	Methylation in Control	1.22E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in HIV infection			[ 6 ]
Location	Body (cg16984553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.48E+00	Statistic Test	p-value: 3.48E-05; Z-score: 1.52E+00
Methylation in Case	9.05E-02 (Median)	Methylation in Control	6.11E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A23 in HIV infection			[ 6 ]
Location	Body (cg15032604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 6.75E-03; Z-score: -8.10E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in lung adenocarcinoma			[ 7 ]
Location	TSS1500 (cg01585293)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 6.38E-03; Z-score: 2.62E+00
Methylation in Case	1.41E-01 (Median)	Methylation in Control	1.16E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in lung adenocarcinoma			[ 7 ]
Location	TSS1500 (cg14527280)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 1.31E-02; Z-score: 2.20E+00
Methylation in Case	9.24E-02 (Median)	Methylation in Control	7.01E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in lung adenocarcinoma			[ 7 ]
Location	1stExon (cg06662991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 2.41E-02; Z-score: 3.31E+00
Methylation in Case	1.39E-01 (Median)	Methylation in Control	1.07E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in lung adenocarcinoma			[ 7 ]
Location	Body (cg01163597)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 2.16E-02; Z-score: 2.27E+00
Methylation in Case	2.03E-01 (Median)	Methylation in Control	1.66E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in lung adenocarcinoma			[ 7 ]
Location	Body (cg16984553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 4.32E-02; Z-score: 3.13E+00
Methylation in Case	1.39E-01 (Median)	Methylation in Control	1.05E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in pancretic ductal adenocarcinoma			[ 8 ]
Location	TSS1500 (cg22117918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 5.32E-14; Z-score: -2.04E+00
Methylation in Case	1.97E-01 (Median)	Methylation in Control	3.17E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in pancretic ductal adenocarcinoma			[ 8 ]
Location	1stExon (cg19791003)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 2.23E-04; Z-score: 3.58E-01
Methylation in Case	4.46E-02 (Median)	Methylation in Control	4.16E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg15618336)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 1.25E-16; Z-score: -2.79E+00
Methylation in Case	6.90E-01 (Median)	Methylation in Control	8.64E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg12228245)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.36E-05; Z-score: -7.12E-02
Methylation in Case	7.35E-02 (Median)	Methylation in Control	7.50E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg21995147)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 2.28E-03; Z-score: 8.84E-01
Methylation in Case	8.85E-01 (Median)	Methylation in Control	8.13E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A23 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg07560932)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.43E-03; Z-score: 5.59E-01
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.69E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A23 in pancretic ductal adenocarcinoma			[ 8 ]
Location	Body (cg18984165)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.68E-03; Z-score: -1.20E-01
Methylation in Case	7.94E-01 (Median)	Methylation in Control	7.99E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in systemic lupus erythematosus			[ 9 ]
Location	TSS1500 (cg05989628)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.98E-02; Z-score: -1.25E-01
Methylation in Case	5.54E-02 (Median)	Methylation in Control	5.72E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in systemic lupus erythematosus			[ 9 ]
Location	Body (cg13318241)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.22E-02; Z-score: 2.27E-01
Methylation in Case	7.12E-01 (Median)	Methylation in Control	6.76E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	1stExon (cg04086786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.99E+00	Statistic Test	p-value: 6.73E-25; Z-score: 6.03E+00
Methylation in Case	5.00E-01 (Median)	Methylation in Control	1.68E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	1stExon (cg06662991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 4.70E-23; Z-score: -3.19E+00
Methylation in Case	5.75E-01 (Median)	Methylation in Control	7.93E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg01163597)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 5.05E-05; Z-score: -9.45E-01
Methylation in Case	6.79E-01 (Median)	Methylation in Control	7.53E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg10091752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.71E+00	Statistic Test	p-value: 1.36E-02; Z-score: 7.59E-01
Methylation in Case	4.06E-01 (Median)	Methylation in Control	2.37E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg13318241)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.40E-02; Z-score: 4.22E-01
Methylation in Case	8.07E-01 (Median)	Methylation in Control	7.51E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	1stExon (cg06662991)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 5.27E-06; Z-score: -6.77E-01
Methylation in Case	6.60E-02 (Median)	Methylation in Control	7.30E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	1stExon (cg04086786)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 8.29E-03; Z-score: -5.71E-01
Methylation in Case	4.48E-02 (Median)	Methylation in Control	5.36E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	Body (cg25822376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 8.49E-17; Z-score: -5.42E+00
Methylation in Case	4.99E-01 (Median)	Methylation in Control	7.47E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	Body (cg22631918)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.42E-14; Z-score: 1.25E+00
Methylation in Case	8.87E-01 (Median)	Methylation in Control	7.83E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	Body (cg04437194)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 1.15E-12; Z-score: -5.98E+00
Methylation in Case	7.04E-01 (Median)	Methylation in Control	8.73E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	Body (cg11201401)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 2.08E-12; Z-score: 2.80E+00
Methylation in Case	5.76E-01 (Median)	Methylation in Control	4.72E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	Body (cg02793415)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 4.17E-10; Z-score: -3.11E+00
Methylation in Case	6.25E-01 (Median)	Methylation in Control	7.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	Body (cg16984553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.32E+00	Statistic Test	p-value: 4.20E-08; Z-score: -1.22E+00
Methylation in Case	5.81E-02 (Median)	Methylation in Control	7.67E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	Body (cg13318241)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 2.41E-07; Z-score: -1.76E+00
Methylation in Case	4.18E-01 (Median)	Methylation in Control	5.44E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	Body (cg10091752)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.37E+00	Statistic Test	p-value: 3.09E-07; Z-score: -1.74E+00
Methylation in Case	2.20E-01 (Median)	Methylation in Control	3.01E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC22A23 in hepatocellular carcinoma			[ 11 ]
Location	Body (cg15032604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 8.09E-03; Z-score: -6.65E-01
Methylation in Case	7.93E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in panic disorder			[ 12 ]
Location	Body (cg16984553)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -9.73E-01	Statistic Test	p-value: 4.99E-02; Z-score: -2.07E-01
Methylation in Case	-5.01E+00 (Median)	Methylation in Control	-4.87E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in papillary thyroid cancer			[ 13 ]
Location	Body (cg15032604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.09E-03; Z-score: -4.09E-01
Methylation in Case	9.06E-01 (Median)	Methylation in Control	9.16E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC22A23 in papillary thyroid cancer			[ 13 ]
Location	Body (cg13318241)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.13E-03; Z-score: 9.58E-01
Methylation in Case	9.09E-01 (Median)	Methylation in Control	8.78E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC22A23 in prostate cancer			[ 14 ]
Location	Body (cg09705798)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.68E+00	Statistic Test	p-value: 6.03E-03; Z-score: -1.03E+01
Methylation in Case	5.01E-01 (Median)	Methylation in Control	8.40E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	40 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-106a directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-106a	miRNA Mature ID	miR-106a-5p
miRNA Sequence	AAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-106b directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-106b	miRNA Mature ID	miR-106b-5p
miRNA Sequence	UAAAGUGCUGACAGUGCAGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-142 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-142	miRNA Mature ID	miR-142-5p
miRNA Sequence	CAUAAAGUAGAAAGCACUACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-17 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-17	miRNA Mature ID	miR-17-5p
miRNA Sequence	CAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-20a directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-20a	miRNA Mature ID	miR-20a-5p
miRNA Sequence	UAAAGUGCUUAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-20b directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-20b	miRNA Mature ID	miR-20b-5p
miRNA Sequence	CAAAGUGCUCAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-302a directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-302a	miRNA Mature ID	miR-302a-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUUGGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-302b directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-302b	miRNA Mature ID	miR-302b-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUUAGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-302c directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-302c	miRNA Mature ID	miR-302c-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUCAGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-302d directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-302d	miRNA Mature ID	miR-302d-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUGAGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-302e directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-302e	miRNA Mature ID	miR-302e
miRNA Sequence	UAAGUGCUUCCAUGCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-3127 directly targets SLC22A23			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-3127	miRNA Mature ID	miR-3127-5p
miRNA Sequence	AUCAGGGCUUGUGGAAUGGGAAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 13	miR-3609 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3609	miRNA Mature ID	miR-3609
miRNA Sequence	CAAAGUGAUGAGUAAUACUGGCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-372 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-372	miRNA Mature ID	miR-372-3p
miRNA Sequence	AAAGUGCUGCGACAUUUGAGCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-373 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-373	miRNA Mature ID	miR-373-3p
miRNA Sequence	GAAGUGCUUCGAUUUUGGGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-378a directly targets SLC22A23			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-378a	miRNA Mature ID	miR-378a-3p
miRNA Sequence	ACUGGACUUGGAGUCAGAAGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 17	miR-383 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-383	miRNA Mature ID	miR-383-5p
miRNA Sequence	AGAUCAGAAGGUGAUUGUGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-4276 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4276	miRNA Mature ID	miR-4276
miRNA Sequence	CUCAGUGACUCAUGUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-4510 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4510	miRNA Mature ID	miR-4510
miRNA Sequence	UGAGGGAGUAGGAUGUAUGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-4772 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4772	miRNA Mature ID	miR-4772-5p
miRNA Sequence	UGAUCAGGCAAAAUUGCAGACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-4796 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4796	miRNA Mature ID	miR-4796-3p
miRNA Sequence	UAAAGUGGCAGAGUAUAGACAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-5094 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5094	miRNA Mature ID	miR-5094
miRNA Sequence	AAUCAGUGAAUGCCUUGAACCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-5190 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5190	miRNA Mature ID	miR-5190
miRNA Sequence	CCAGUGACUGAGCUGGAGCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-519d directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-519d	miRNA Mature ID	miR-519d-3p
miRNA Sequence	CAAAGUGCCUCCCUUUAGAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-520a directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-520a	miRNA Mature ID	miR-520a-3p
miRNA Sequence	AAAGUGCUUCCCUUUGGACUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-520c directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-520c	miRNA Mature ID	miR-520c-3p
miRNA Sequence	AAAGUGCUUCCUUUUAGAGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-520d directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-520d	miRNA Mature ID	miR-520d-3p
miRNA Sequence	AAAGUGCUUCUCUUUGGUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-520f directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-520f	miRNA Mature ID	miR-520f-3p
miRNA Sequence	AAGUGCUUCCUUUUAGAGGGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-526b directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-526b	miRNA Mature ID	miR-526b-3p
miRNA Sequence	GAAAGUGCUUCCUUUUAGAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-548ah directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548ah	miRNA Mature ID	miR-548ah-5p
miRNA Sequence	AAAAGUGAUUGCAGUGUUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-5590 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5590	miRNA Mature ID	miR-5590-3p
miRNA Sequence	AAUAAAGUUCAUGUAUGGCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-6127 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6127	miRNA Mature ID	miR-6127
miRNA Sequence	UGAGGGAGUGGGUGGGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-6129 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6129	miRNA Mature ID	miR-6129
miRNA Sequence	UGAGGGAGUUGGGUGUAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-6130 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6130	miRNA Mature ID	miR-6130
miRNA Sequence	UGAGGGAGUGGAUUGUAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-6133 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6133	miRNA Mature ID	miR-6133
miRNA Sequence	UGAGGGAGGAGGUUGGGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-6731 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6731	miRNA Mature ID	miR-6731-5p
miRNA Sequence	UGGGAGAGCAGGGUAUUGUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-6760 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6760	miRNA Mature ID	miR-6760-5p
miRNA Sequence	CAGGGAGAAGGUGGAAGUGCAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 38	miR-6873 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6873	miRNA Mature ID	miR-6873-5p
miRNA Sequence	CAGAGGGAAUACAGAGGGCAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 39	miR-8085 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8085	miRNA Mature ID	miR-8085
miRNA Sequence	UGGGAGAGAGGACUGUGAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 40	miR-93 directly targets SLC22A23			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-93	miRNA Mature ID	miR-93-5p
miRNA Sequence	CAAAGUGCUGUUCGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
12	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
14	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
15	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
16	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence