Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0151 Transporter Info
Gene Name SLC22A4
Transporter Name Organic cation/carnitine transporter 1
Gene ID
6583
UniProt ID
Q9H015
Epigenetic Regulations of This DT (EGR)

Methylation

  Hepatocellular carcinoma

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 5'UTR (cg23955881)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 7.22E-11; Z-score: -5.10E+00

Methylation in Case

 5.78E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg26922038)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.44E+00 Statistic Test p-value: 1.12E-13; Z-score: -3.79E+00

Methylation in Case

 4.81E-01 (Median) Methylation in Control 6.93E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 1.98E-03; Z-score: -8.38E-01

Methylation in Case

 6.28E-02 (Median) Methylation in Control 7.75E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg11083715)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 1.89E-10; Z-score: -2.47E+00

Methylation in Case

 4.86E-01 (Median) Methylation in Control 6.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.02E-05; Z-score: -1.23E+00

Methylation in Case

 7.95E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.70E-03; Z-score: -3.58E-01

Methylation in Case

 7.99E-01 (Median) Methylation in Control 8.10E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 8.78E-03; Z-score: 1.39E+00

Methylation in Case

 5.26E-01 (Median) Methylation in Control 4.15E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.59E-02; Z-score: -2.19E-01

Methylation in Case

 7.70E-01 (Median) Methylation in Control 7.92E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.44E-02; Z-score: 5.07E-01

Methylation in Case

 9.03E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC22A4 in hepatocellular carcinoma [ 1 ]

Location

 3'UTR (cg01634982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 6.19E-11; Z-score: -3.70E+00

Methylation in Case

 5.91E-01 (Median) Methylation in Control 7.04E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 5'UTR (cg22115748)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.21E-02; Z-score: -8.76E-01

Methylation in Case

 5.17E-01 (Median) Methylation in Control 5.48E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 5'UTR (cg13774987)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.98E-02; Z-score: 4.13E-01

Methylation in Case

 8.42E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS1500 (cg24302235)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.30E+00 Statistic Test p-value: 2.28E-07; Z-score: -1.20E+00

Methylation in Case

 1.10E-01 (Median) Methylation in Control 2.52E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS1500 (cg04544931)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.42E+00 Statistic Test p-value: 5.88E-05; Z-score: -1.24E+00

Methylation in Case

 1.78E-01 (Median) Methylation in Control 2.53E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg07719512)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 2.89E-07; Z-score: -1.30E+00

Methylation in Case

 5.55E-01 (Median) Methylation in Control 6.13E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg07888856)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 9.04E-04; Z-score: 5.88E-01

Methylation in Case

 4.91E-02 (Median) Methylation in Control 4.50E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg26912984)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.39E-03; Z-score: -6.76E-02

Methylation in Case

 1.23E-01 (Median) Methylation in Control 1.24E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 TSS200 (cg05429359)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 1.40E-03; Z-score: -6.72E-01

Methylation in Case

 1.30E-01 (Median) Methylation in Control 1.63E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg17687493)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.37E+00 Statistic Test p-value: 2.10E-30; Z-score: 6.11E+00

Methylation in Case

 2.59E-01 (Median) Methylation in Control 1.09E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg19777470)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 6.76E-03; Z-score: -3.59E-01

Methylation in Case

 2.01E-01 (Median) Methylation in Control 2.16E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC22A4 in pancretic ductal adenocarcinoma [ 2 ]

Location

 Body (cg01019875)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 3.78E-02; Z-score: -5.69E-01

Methylation in Case

 4.51E-01 (Median) Methylation in Control 5.30E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Breast cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 5.63E-05; Z-score: 6.91E-01

Methylation in Case

 6.76E-02 (Median) Methylation in Control 5.33E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 TSS1500 (cg07354253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.96E-02; Z-score: -3.56E-01

Methylation in Case

 1.06E-01 (Median) Methylation in Control 1.11E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 5.08E-03; Z-score: -3.53E-01

Methylation in Case

 7.07E-02 (Median) Methylation in Control 8.21E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 TSS200 (cg11387240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 2.09E-02; Z-score: -3.43E-01

Methylation in Case

 6.32E-02 (Median) Methylation in Control 6.91E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 1stExon (cg17111895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 7.36E-03; Z-score: -5.53E-01

Methylation in Case

 5.06E-02 (Median) Methylation in Control 5.83E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.76E+00 Statistic Test p-value: 4.26E-28; Z-score: -4.08E+00

Methylation in Case

 1.46E-01 (Median) Methylation in Control 4.03E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.00E+00 Statistic Test p-value: 2.90E-23; Z-score: -3.06E+00

Methylation in Case

 1.12E-01 (Median) Methylation in Control 2.25E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 9.00E-08; Z-score: 1.65E+00

Methylation in Case

 8.18E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 9.67E-04; Z-score: -5.63E-01

Methylation in Case

 8.22E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 7.36E-03; Z-score: -8.24E-01

Methylation in Case

 6.80E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC22A4 in breast cancer [ 3 ]

Location

 3'UTR (cg12468553)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 6.42E-05; Z-score: -1.02E+00

Methylation in Case

 8.01E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.61E+00 Statistic Test p-value: 2.76E-05; Z-score: 1.77E+00

Methylation in Case

 2.75E-02 (Median) Methylation in Control 1.71E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg11387240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 1.50E-04; Z-score: 8.47E-01

Methylation in Case

 3.02E-02 (Median) Methylation in Control 2.53E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 2.84E-04; Z-score: 7.17E-01

Methylation in Case

 3.01E-02 (Median) Methylation in Control 2.61E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.15E+00 Statistic Test p-value: 9.26E-08; Z-score: -3.49E+00

Methylation in Case

 1.67E-01 (Median) Methylation in Control 3.58E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.06E+00 Statistic Test p-value: 9.79E-08; Z-score: -2.96E+00

Methylation in Case

 8.75E-02 (Median) Methylation in Control 1.81E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg26317549)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.37E+00 Statistic Test p-value: 4.37E-07; Z-score: -5.36E+00

Methylation in Case

 5.33E-01 (Median) Methylation in Control 7.29E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg27365825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.22E+00 Statistic Test p-value: 7.23E-05; Z-score: 5.05E+00

Methylation in Case

 4.53E-01 (Median) Methylation in Control 2.04E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 TSS200 (cg26851500)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.38E+00 Statistic Test p-value: 3.98E-07; Z-score: -5.28E+00

Methylation in Case

 5.64E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 Body (cg14574489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.35E+00 Statistic Test p-value: 1.42E-05; Z-score: -4.65E+00

Methylation in Case

 5.20E-01 (Median) Methylation in Control 7.03E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in colon adenocarcinoma [ 5 ]

Location

 Body (cg04968806)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 4.26E-05; Z-score: 9.93E-01

Methylation in Case

 5.27E-01 (Median) Methylation in Control 4.43E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg13654253)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.39E+00 Statistic Test p-value: 3.81E-03; Z-score: -6.61E-01

Methylation in Case

 1.92E-02 (Median) Methylation in Control 2.67E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg26229274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 4.68E-02; Z-score: 6.07E-01

Methylation in Case

 7.62E-02 (Median) Methylation in Control 6.85E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 8.16E-04; Z-score: -1.18E+00

Methylation in Case

 2.49E-01 (Median) Methylation in Control 3.57E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.70E-02; Z-score: -5.67E-01

Methylation in Case

 9.13E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in colorectal cancer [ 6 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 3.72E-02; Z-score: 8.64E-01

Methylation in Case

 7.12E-01 (Median) Methylation in Control 5.99E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.35E+00 Statistic Test p-value: 4.10E-03; Z-score: 1.31E+00

Methylation in Case

 9.51E-02 (Median) Methylation in Control 7.04E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS1500 (cg26229274)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 6.00E-03; Z-score: -1.03E+00

Methylation in Case

 4.30E-02 (Median) Methylation in Control 5.20E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS200 (cg11387240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 8.15E-03; Z-score: -6.92E-01

Methylation in Case

 6.71E-02 (Median) Methylation in Control 7.56E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.49E-02; Z-score: -1.24E-01

Methylation in Case

 6.88E-02 (Median) Methylation in Control 7.03E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 TSS200 (cg08833630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 3.68E-02; Z-score: 4.13E-01

Methylation in Case

 2.86E-02 (Median) Methylation in Control 2.52E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 6.49E-08; Z-score: 1.89E+00

Methylation in Case

 8.35E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.36E+00 Statistic Test p-value: 5.32E-05; Z-score: 1.27E+00

Methylation in Case

 5.34E-02 (Median) Methylation in Control 3.92E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 1.78E-04; Z-score: 1.30E+00

Methylation in Case

 6.79E-02 (Median) Methylation in Control 5.27E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.56E-03; Z-score: 6.97E-01

Methylation in Case

 9.04E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.13E-02; Z-score: -6.49E-01

Methylation in Case

 8.79E-01 (Median) Methylation in Control 8.92E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC22A4 in HIV infection [ 7 ]

Location

 3'UTR (cg12468553)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.14E-03; Z-score: -1.20E+00

Methylation in Case

 8.45E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.49E+00 Statistic Test p-value: 1.14E-03; Z-score: 4.40E+00

Methylation in Case

 1.35E-01 (Median) Methylation in Control 9.08E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 TSS200 (cg08833630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 3.62E-02; Z-score: -1.41E+00

Methylation in Case

 4.87E-02 (Median) Methylation in Control 5.88E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 4.77E-04; Z-score: 2.06E+00

Methylation in Case

 8.22E-01 (Median) Methylation in Control 7.14E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.59E-02; Z-score: -2.11E+00

Methylation in Case

 7.88E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.52E-02; Z-score: 1.12E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A4 in lung adenocarcinoma [ 8 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 3.94E-02; Z-score: -1.32E+00

Methylation in Case

 3.05E-01 (Median) Methylation in Control 4.02E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in prostate cancer [ 9 ]

Location

 TSS1500 (cg23413506)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.40E+00 Statistic Test p-value: 2.74E-03; Z-score: 3.34E+00

Methylation in Case

 8.03E-01 (Median) Methylation in Control 5.73E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in prostate cancer [ 9 ]

Location

 Body (cg25620760)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 2.08E-03; Z-score: 3.24E+00

Methylation in Case

 8.90E-01 (Median) Methylation in Control 7.33E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in systemic lupus erythematosus [ 10 ]

Location

 TSS1500 (cg13373085)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 8.65E-03; Z-score: 2.15E-01

Methylation in Case

 1.38E-01 (Median) Methylation in Control 1.25E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in systemic lupus erythematosus [ 10 ]

Location

 TSS200 (cg11387240)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.49E-02; Z-score: -4.77E-02

Methylation in Case

 9.44E-02 (Median) Methylation in Control 9.53E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in systemic lupus erythematosus [ 10 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.71E-02; Z-score: -1.29E-01

Methylation in Case

 8.43E-02 (Median) Methylation in Control 8.63E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in systemic lupus erythematosus [ 10 ]

Location

 1stExon (cg17111895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.58E-02; Z-score: -1.40E-01

Methylation in Case

 8.06E-02 (Median) Methylation in Control 8.27E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.35E+00 Statistic Test p-value: 1.61E-03; Z-score: -2.82E+00

Methylation in Case

 8.45E-02 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 TSS200 (cg08833630)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.39E+00 Statistic Test p-value: 3.62E-02; Z-score: -1.90E+00

Methylation in Case

 3.05E-02 (Median) Methylation in Control 4.24E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 1stExon (cg17111895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 9.60E-03; Z-score: -1.70E+00

Methylation in Case

 5.66E-02 (Median) Methylation in Control 6.45E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -4.14E+00 Statistic Test p-value: 7.65E-07; Z-score: -7.49E+00

Methylation in Case

 1.02E-01 (Median) Methylation in Control 4.20E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 8.75E-05; Z-score: -6.39E+00

Methylation in Case

 4.68E-01 (Median) Methylation in Control 6.22E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.12E+00 Statistic Test p-value: 3.49E-04; Z-score: -3.61E+00

Methylation in Case

 6.50E-02 (Median) Methylation in Control 1.38E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.61E-04; Z-score: -2.28E+00

Methylation in Case

 7.93E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 3.46E-03; Z-score: 2.34E+00

Methylation in Case

 8.43E-01 (Median) Methylation in Control 7.65E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC22A4 in bladder cancer [ 11 ]

Location

 3'UTR (cg12468553)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.39E-02; Z-score: -1.45E+00

Methylation in Case

 7.83E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 TSS200 (cg07810106)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 5.53E-03; Z-score: -3.30E-01

Methylation in Case

 5.88E-02 (Median) Methylation in Control 6.29E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 1.04E-17; Z-score: -2.52E+00

Methylation in Case

 3.07E-01 (Median) Methylation in Control 4.92E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg19848599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 2.92E-08; Z-score: 9.72E-01

Methylation in Case

 7.71E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.35E+00 Statistic Test p-value: 7.18E-08; Z-score: -1.18E+00

Methylation in Case

 9.06E-02 (Median) Methylation in Control 1.22E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg16087826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.26E-06; Z-score: -9.77E-01

Methylation in Case

 8.60E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg26794221)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 1.72E-03; Z-score: 1.43E+00

Methylation in Case

 6.26E-01 (Median) Methylation in Control 5.24E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC22A4 in papillary thyroid cancer [ 12 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.40E-02; Z-score: 8.68E-01

Methylation in Case

 9.02E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 1stExon (cg17111895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.71E+00 Statistic Test p-value: 7.15E-18; Z-score: -2.44E+00

Methylation in Case

 3.93E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC22A4 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 Body (cg04470557)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 7.90E-04; Z-score: 5.06E-01

Methylation in Case

 8.97E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC22A4 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 Body (cg05231888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.34E-03; Z-score: 7.68E-01

Methylation in Case

 7.59E-01 (Median) Methylation in Control 6.74E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC22A4 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 3'UTR (cg12468553)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.57E+00 Statistic Test p-value: 1.39E-11; Z-score: 1.84E+00

Methylation in Case

 2.76E-01 (Median) Methylation in Control 1.76E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Celiac disease

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC22A4 in celiac disease [ 14 ]

Location

 Body (cg25350825)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.67E-02; Z-score: -8.98E-01

Methylation in Case

 9.27E-01 (Median) Methylation in Control 9.56E-01 (Median)

Studied Phenotype

 Celiac disease [ ICD-11: DA95]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-329 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-329 miRNA Mature ID miR-329-3p

miRNA Sequence

 AACACACCUGGUUAACCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-362 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-362 miRNA Mature ID miR-362-3p

miRNA Sequence

 AACACACCUAUUCAAGGAUUCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-3941 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3941 miRNA Mature ID miR-3941

miRNA Sequence

 UUACACACAACUGAGGAUCAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-4789 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-3p

miRNA Sequence

 CACACAUAGCAGGUGUAUAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-603 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-603 miRNA Mature ID miR-603

miRNA Sequence

 CACACACUGCAAUUACUUUUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-6755 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6755 miRNA Mature ID miR-6755-3p

miRNA Sequence

 UGUUGUCAUGUUUUUUCCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-6879 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6879 miRNA Mature ID miR-6879-3p

miRNA Sequence

 UGUCACCCGCUCCUUGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-8485 directly targets SLC22A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-8485 miRNA Mature ID miR-8485

miRNA Sequence

 CACACACACACACACACGUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
10 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
11 DNA Methylation Dynamics in Urological Tumors.
12 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
13 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
14 The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.