Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0158 Transporter Info | ||||
Gene Name | SLC23A1 | ||||
Transporter Name | Sodium-dependent vitamin C transporter 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Histone acetylation |
|||||
Colon |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Hypoacetylation of SLC23A1 in colon (compare with jejunum tissue of human) | [ 1 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
Related Molecular Changes |
Down regulation of SLC23A1 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Colon | ||||
Experimental Material |
Patients samples of human | ||||
Additional Notes |
Lower levels of H3 acethylation of lysine 9 and lower gene expression was observed in the SLC23A1 promoter in the colon. | ||||
Histone trimethylation |
|||||
Colon |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Lower level of histone trimethylation of SLC23A1 in colon (compare with jejunum tissue of human) | [ 1 ] | |||
Location |
Promoter | ||||
Epigenetic Type |
Histone trimethylation | Experiment Method | Chromatin immunoprecipitation | ||
Related Molecular Changes |
Down regulation of SLC23A1 | Experiment Method | RT-qPCR | ||
Studied Phenotype |
Colon | ||||
Experimental Material |
Patients samples of human | ||||
Additional Notes |
Lower levels of H3 trimethylation of lysine 4 and lower gene expression was observed in the SLC23A1 promoter in the colon. | ||||
microRNA |
|||||
Unclear Phenotype |
29 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1179 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1179 | miRNA Mature ID | miR-1179 | ||
miRNA Sequence |
AAGCAUUCUUUCAUUGGUUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-1185 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1185 | miRNA Mature ID | miR-1185-5p | ||
miRNA Sequence |
AGAGGAUACCCUUUGUAUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-1224 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1224 | miRNA Mature ID | miR-1224-5p | ||
miRNA Sequence |
GUGAGGACUCGGGAGGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-140 directly targets SLC23A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-140 | miRNA Mature ID | miR-140-3p | ||
miRNA Sequence |
UACCACAGGGUAGAACCACGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-203a directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-203a | miRNA Mature ID | miR-203a-3p | ||
miRNA Sequence |
GUGAAAUGUUUAGGACCACUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-224 directly targets SLC23A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-224 | miRNA Mature ID | miR-224-3p | ||
miRNA Sequence |
AAAAUGGUGCCCUAGUGACUACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-3605 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3605 | miRNA Mature ID | miR-3605-5p | ||
miRNA Sequence |
UGAGGAUGGAUAGCAAGGAAGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-3649 directly targets SLC23A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3649 | miRNA Mature ID | miR-3649 | ||
miRNA Sequence |
AGGGACCUGAGUGUCUAAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-3650 directly targets SLC23A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3650 | miRNA Mature ID | miR-3650 | ||
miRNA Sequence |
AGGUGUGUCUGUAGAGUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 10 |
miR-3662 directly targets SLC23A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3662 | miRNA Mature ID | miR-3662 | ||
miRNA Sequence |
GAAAAUGAUGAGUAGUGACUGAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 11 |
miR-3679 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3679 | miRNA Mature ID | miR-3679-5p | ||
miRNA Sequence |
UGAGGAUAUGGCAGGGAAGGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-3915 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3915 | miRNA Mature ID | miR-3915 | ||
miRNA Sequence |
UUGAGGAAAAGAUGGUCUUAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-4321 directly targets SLC23A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4321 | miRNA Mature ID | miR-4321 | ||
miRNA Sequence |
UUAGCGGUGGACCGCCCUGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 14 |
miR-4689 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4689 | miRNA Mature ID | miR-4689 | ||
miRNA Sequence |
UUGAGGAGACAUGGUGGGGGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-4781 directly targets SLC23A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4781 | miRNA Mature ID | miR-4781-5p | ||
miRNA Sequence |
UAGCGGGGAUUCCAAUAUUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 16 |
miR-5009 directly targets SLC23A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5009 | miRNA Mature ID | miR-5009-3p | ||
miRNA Sequence |
UCCUAAAUCUGAAAGUCCAAAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 17 |
miR-510 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-510 | miRNA Mature ID | miR-510-3p | ||
miRNA Sequence |
AUUGAAACCUCUAAGAGUGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-5193 directly targets SLC23A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5193 | miRNA Mature ID | miR-5193 | ||
miRNA Sequence |
UCCUCCUCUACCUCAUCCCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 19 |
miR-522 directly targets SLC23A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-522 | miRNA Mature ID | miR-522-3p | ||
miRNA Sequence |
AAAAUGGUUCCCUUUAGAGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-526b directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-526b | miRNA Mature ID | miR-526b-5p | ||
miRNA Sequence |
CUCUUGAGGGAAGCACUUUCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 21 |
miR-562 directly targets SLC23A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-562 | miRNA Mature ID | miR-562 | ||
miRNA Sequence |
AAAGUAGCUGUACCAUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-574 directly targets SLC23A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-574 | miRNA Mature ID | miR-574-5p | ||
miRNA Sequence |
UGAGUGUGUGUGUGUGAGUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 23 |
miR-660 directly targets SLC23A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-660 | miRNA Mature ID | miR-660-3p | ||
miRNA Sequence |
ACCUCCUGUGUGCAUGGAUUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 24 |
miR-6791 directly targets SLC23A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6791 | miRNA Mature ID | miR-6791-3p | ||
miRNA Sequence |
UGCCUCCUUGGUCUCCGGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-6829 directly targets SLC23A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6829 | miRNA Mature ID | miR-6829-3p | ||
miRNA Sequence |
UGCCUCCUCCGUGGCCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 26 |
miR-6858 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6858 | miRNA Mature ID | miR-6858-5p | ||
miRNA Sequence |
GUGAGGAGGGGCUGGCAGGGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 27 |
miR-6867 directly targets SLC23A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6867 | miRNA Mature ID | miR-6867-5p | ||
miRNA Sequence |
UGUGUGUGUAGAGGAAGAAGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 28 |
miR-6881 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6881 | miRNA Mature ID | miR-6881-3p | ||
miRNA Sequence |
AUCCUCUUUCGUCCUUCCCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 29 |
miR-877 directly targets SLC23A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-877 | miRNA Mature ID | miR-877-3p | ||
miRNA Sequence |
UCCUCUUCUCCCUCCUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.