Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0159 Transporter Info
Gene Name SLC23A2
Transporter Name Sodium-dependent vitamin C transporter 2
Gene ID
9962
UniProt ID
Q9UGH3
Epigenetic Regulations of This DT (EGR)

Methylation

  Spinal muscular atrophy

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypomethylation of SLC23A2 in spinal muscular atrophy [ 1 ]

Location

 Promoter

Epigenetic Type

 Methylation Experiment Method Bisulfite sequencing

Related Molecular Changes

 Up regulation of SLC23A2 Experiment Method RT-qPCR

Studied Phenotype

 Spinal muscular atrophy [ ICD-11: 8B61]

Experimental Material

 Patient tissue samples

Additional Notes

 Lower methylation levels in type III-IV compared to type I SMA patients might suggest higher SLC23A2 expression level.

  Atypical teratoid rhabdoid tumor

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in atypical teratoid rhabdoid tumor [ 2 ]

Location

 5'UTR (cg12821724)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 3.88E-07; Z-score: -1.35E+00

Methylation in Case

 5.93E-01 (Median) Methylation in Control 7.58E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in bladder cancer [ 3 ]

Location

 5'UTR (cg12821724)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.21E+00 Statistic Test p-value: 5.58E-12; Z-score: -1.20E+01

Methylation in Case

 2.96E-01 (Median) Methylation in Control 6.54E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC23A2 in bladder cancer [ 3 ]

Location

 TSS1500 (cg25554205)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.04E+00 Statistic Test p-value: 7.22E-12; Z-score: -3.61E+01

Methylation in Case

 4.14E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC23A2 in bladder cancer [ 3 ]

Location

 TSS1500 (cg01162053)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 3.40E-05; Z-score: -4.52E+00

Methylation in Case

 7.68E-01 (Median) Methylation in Control 9.10E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC23A2 in bladder cancer [ 3 ]

Location

 TSS200 (cg10150176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.20E+00 Statistic Test p-value: 6.59E-15; Z-score: -2.64E+01

Methylation in Case

 2.29E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC23A2 in bladder cancer [ 3 ]

Location

 TSS200 (cg17978727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.96E+00 Statistic Test p-value: 5.63E-09; Z-score: -8.32E+00

Methylation in Case

 1.29E-01 (Median) Methylation in Control 3.83E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in breast cancer [ 4 ]

Location

 5'UTR (cg12821724)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.81E-02; Z-score: -4.71E-01

Methylation in Case

 6.87E-01 (Median) Methylation in Control 7.22E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC23A2 in breast cancer [ 4 ]

Location

 TSS200 (cg17978727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 1.34E-08; Z-score: -1.83E+00

Methylation in Case

 3.20E-01 (Median) Methylation in Control 4.51E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC23A2 in breast cancer [ 4 ]

Location

 TSS200 (cg10150176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 2.82E-03; Z-score: -6.52E-01

Methylation in Case

 7.34E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in colorectal cancer [ 5 ]

Location

 5'UTR (cg12821724)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 8.70E-08; Z-score: -2.20E+00

Methylation in Case

 8.33E-01 (Median) Methylation in Control 8.99E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC23A2 in colorectal cancer [ 5 ]

Location

 TSS200 (cg17978727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 9.53E-10; Z-score: -2.20E+00

Methylation in Case

 5.28E-01 (Median) Methylation in Control 6.70E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC23A2 in colorectal cancer [ 5 ]

Location

 TSS200 (cg10150176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.24E-07; Z-score: -2.14E+00

Methylation in Case

 8.68E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg12821724)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 8.01E-03; Z-score: -2.97E-01

Methylation in Case

 7.77E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC23A2 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg25554205)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 4.51E-03; Z-score: -1.72E-01

Methylation in Case

 8.75E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC23A2 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg17978727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 2.89E-09; Z-score: -1.57E+00

Methylation in Case

 4.48E-01 (Median) Methylation in Control 5.49E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC23A2 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg10150176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 5.36E-06; Z-score: -1.02E+00

Methylation in Case

 7.79E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in panic disorder [ 7 ]

Location

 5'UTR (cg12821724)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.76E-02; Z-score: 3.00E-01

Methylation in Case

 2.31E+00 (Median) Methylation in Control 2.21E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in HIV infection [ 8 ]

Location

 TSS200 (cg17978727)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 2.93E-06; Z-score: -1.89E+00

Methylation in Case

 3.70E-01 (Median) Methylation in Control 4.66E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC23A2 in HIV infection [ 8 ]

Location

 TSS200 (cg10150176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.73E-02; Z-score: -7.89E-01

Methylation in Case

 8.39E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in papillary thyroid cancer [ 9 ]

Location

 TSS200 (cg10150176)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.77E-03; Z-score: -6.40E-01

Methylation in Case

 8.29E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg08830157)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.31E+00 Statistic Test p-value: 3.56E-04; Z-score: -1.03E+00

Methylation in Case

 4.38E-01 (Median) Methylation in Control 5.76E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC23A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg19903766)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 2.40E-02; Z-score: 8.45E-01

Methylation in Case

 4.77E-01 (Median) Methylation in Control 4.32E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC23A2 in prostate cancer [ 11 ]

Location

 Body (cg14137381)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.47E+00 Statistic Test p-value: 4.13E-02; Z-score: 4.10E+00

Methylation in Case

 7.43E-01 (Median) Methylation in Control 5.07E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Obesity

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC23A2 in obesity than that in healthy individual

Studied Phenotype

 Obesity [ICD-11:5B81]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 3.18E-41; Fold-change: 0.315967601; Z-score: 2.494075499
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Lymphoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC23A2 in lymphoma than that in healthy individual

Studied Phenotype

 Lymphoma [ICD-11:2B30]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.52E-10; Fold-change: -0.32994115; Z-score: -11.06018824
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

Histone acetylation

  Colon

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypoacetylation of SLC23A2 in colon (compare with jejunum tissue of human) [ 12 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC23A2 Experiment Method RT-qPCR

Studied Phenotype

 Colon

Experimental Material

 Patients samples of human

Additional Notes

 Lower levels of H3 acethylation of lysine 9 and lower gene expression was observed in the SLC23A2 promoter in the colon.

Histone trimethylation

  Chronic alcohol exposure

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Higher level of histone trimethylation of SLC23A2 in chronic alcohol exposure (compare with counterpart normal pancreatic acinar rat cells) [ 13 ]

Location

 Promoter

Epigenetic Type

 Histone trimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC23A2 Experiment Method Western Blot

Studied Phenotype

 Chronic alcohol exposure [ ICD-11: 6C40.2Z]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 Chronic exposure of mouse pancreatic acinar tumor cells to alcohol is associated with a significant increase in the level of the H3K27me3 (a repressive mark) of the Slc23a2.

  Epigenetic Phenomenon 2

 Lower level of histone trimethylation of SLC23A2 in chronic alcohol exposure (compare with counterpart normal pancreatic acinar rat cells) [ 13 ]

Location

 Promoter

Epigenetic Type

 Histone trimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC23A2 Experiment Method Western Blot

Studied Phenotype

 Chronic alcohol exposure [ ICD-11: 6C40.2Z]

Experimental Material

 Model organism in vivo (mouse)

Additional Notes

 Chronic exposure of mouse pancreatic acinar tumor cells to alcohol is associated with a significant reduction in the level of expression of H3K4me3 (an activation mark) of the Slc23a2.

  Colon

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Lower level of histone trimethylation of SLC23A2 in colon (compare with jejunum tissue of human) [ 12 ]

Location

 Promoter

Epigenetic Type

 Histone trimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC23A2 Experiment Method RT-qPCR

Studied Phenotype

 Colon

Experimental Material

 Patients samples of human

Additional Notes

 Lower levels of H3 trimethylation of lysine 4 and lower gene expression was observed in the SLC23A2 promoter in the colon.

microRNA

  Unclear Phenotype

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-196b directly targets SLC23A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-196b miRNA Mature ID miR-196b-5p

miRNA Sequence

 UAGGUAGUUUCCUGUUGUUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-320b directly targets SLC23A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-320b miRNA Mature ID miR-320b

miRNA Sequence

 AAAAGCUGGGUUGAGAGGGCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Methylation levels of SLC23A2 and NCOR2 genes correlate with spinal muscular atrophy severity. PLoS One. 2015 Mar 30;10(3):e0121964.
2 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
8 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
12 Molecular mechanism(s) involved in differential expression of vitamin C transporters along the intestinal tract. Am J Physiol Gastrointest Liver Physiol. 2017 Apr 1;312(4):G340-G347.
13 Uptake of ascorbic acid by pancreatic acinar cells is negatively impacted by chronic alcohol exposure. Am J Physiol Cell Physiol. 2016 Jul 1;311(1):C129-35.
14 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.