Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0163 Transporter Info
Gene Name SLC24A2
Transporter Name Sodium/potassium/calcium exchanger 2
Gene ID
25769
UniProt ID
Q9UI40
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg24305584)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.12E+00 Statistic Test p-value: 1.03E-07; Z-score: 6.62E+00

Methylation in Case

 4.58E-01 (Median) Methylation in Control 1.47E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in colon adenocarcinoma [ 1 ]

Location

 TSS200 (cg19697725)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 6.49E-05; Z-score: 1.28E+00

Methylation in Case

 2.51E-01 (Median) Methylation in Control 2.19E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in hepatocellular carcinoma [ 2 ]

Location

 5'UTR (cg15549810)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.63E+00 Statistic Test p-value: 1.89E-18; Z-score: -3.02E+00

Methylation in Case

 3.93E-01 (Median) Methylation in Control 6.40E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg27648056)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.64E+00 Statistic Test p-value: 9.54E-21; Z-score: -5.54E+00

Methylation in Case

 4.26E-01 (Median) Methylation in Control 6.99E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A2 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg07581739)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.58E+00 Statistic Test p-value: 2.47E-17; Z-score: -7.62E+00

Methylation in Case

 5.38E-01 (Median) Methylation in Control 8.52E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A2 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg24149278)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.64E+00 Statistic Test p-value: 3.63E-17; Z-score: -4.11E+00

Methylation in Case

 3.80E-01 (Median) Methylation in Control 6.24E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A2 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg14414100)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.45E+00 Statistic Test p-value: 5.79E-07; Z-score: -2.24E+00

Methylation in Case

 1.86E-01 (Median) Methylation in Control 2.69E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in bladder cancer [ 3 ]

Location

 TSS1500 (cg14442421)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.03E+00 Statistic Test p-value: 1.35E-06; Z-score: 2.98E+01

Methylation in Case

 3.56E-01 (Median) Methylation in Control 8.82E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in bladder cancer [ 3 ]

Location

 TSS1500 (cg14439761)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.52E+00 Statistic Test p-value: 1.02E-03; Z-score: 5.45E+00

Methylation in Case

 1.49E-01 (Median) Methylation in Control 5.91E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A2 in bladder cancer [ 3 ]

Location

 TSS200 (cg02203420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 4.95E-05; Z-score: -1.94E+01

Methylation in Case

 6.96E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A2 in bladder cancer [ 3 ]

Location

 1stExon (cg12348970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.49E+00 Statistic Test p-value: 2.52E-07; Z-score: -1.94E+01

Methylation in Case

 5.93E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A2 in bladder cancer [ 3 ]

Location

 Body (cg13661323)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 7.82E-08; Z-score: -1.27E+01

Methylation in Case

 5.87E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A2 in bladder cancer [ 3 ]

Location

 Body (cg14404146)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 2.48E-07; Z-score: -6.21E+00

Methylation in Case

 6.77E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in breast cancer [ 4 ]

Location

 TSS1500 (cg14442421)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.34E+00 Statistic Test p-value: 3.94E-16; Z-score: 3.74E+00

Methylation in Case

 2.16E-01 (Median) Methylation in Control 9.21E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in breast cancer [ 4 ]

Location

 TSS1500 (cg14439761)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.61E+00 Statistic Test p-value: 2.41E-08; Z-score: 2.03E+00

Methylation in Case

 9.96E-02 (Median) Methylation in Control 6.18E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A2 in breast cancer [ 4 ]

Location

 TSS200 (cg02203420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 6.91E-13; Z-score: -2.78E+00

Methylation in Case

 6.19E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A2 in breast cancer [ 4 ]

Location

 1stExon (cg12348970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 2.87E-10; Z-score: -2.94E+00

Methylation in Case

 7.55E-01 (Median) Methylation in Control 8.49E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A2 in breast cancer [ 4 ]

Location

 Body (cg13661323)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 6.88E-11; Z-score: -2.37E+00

Methylation in Case

 6.99E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A2 in breast cancer [ 4 ]

Location

 Body (cg14404146)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.71E-03; Z-score: -8.82E-01

Methylation in Case

 8.17E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC24A2 in breast cancer [ 4 ]

Location

 Body (cg14414100)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 4.60E-02; Z-score: 8.82E-01

Methylation in Case

 3.69E-01 (Median) Methylation in Control 3.16E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in clear cell renal cell carcinoma [ 5 ]

Location

 TSS1500 (cg14442421)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 5.93E+00 Statistic Test p-value: 3.78E-09; Z-score: 9.40E+00

Methylation in Case

 1.86E-01 (Median) Methylation in Control 3.13E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in clear cell renal cell carcinoma [ 5 ]

Location

 1stExon (cg12348970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.44E-04; Z-score: -2.52E+00

Methylation in Case

 9.60E-01 (Median) Methylation in Control 9.77E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg14439761)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.62E+00 Statistic Test p-value: 5.84E-13; Z-score: 3.62E+00

Methylation in Case

 5.44E-01 (Median) Methylation in Control 2.08E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg14442421)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.36E+00 Statistic Test p-value: 9.17E-05; Z-score: 1.41E+00

Methylation in Case

 7.04E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A2 in colorectal cancer [ 6 ]

Location

 TSS200 (cg02203420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 5.26E-08; Z-score: -4.34E+00

Methylation in Case

 8.39E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A2 in colorectal cancer [ 6 ]

Location

 1stExon (cg12348970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.45E-07; Z-score: -4.99E+00

Methylation in Case

 8.64E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A2 in colorectal cancer [ 6 ]

Location

 Body (cg13661323)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 9.34E-13; Z-score: -6.54E+00

Methylation in Case

 7.51E-01 (Median) Methylation in Control 8.86E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A2 in colorectal cancer [ 6 ]

Location

 Body (cg14404146)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 9.12E-11; Z-score: -2.35E+00

Methylation in Case

 8.54E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg14442421)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.86E+00 Statistic Test p-value: 2.04E-03; Z-score: 7.40E+00

Methylation in Case

 3.07E-01 (Median) Methylation in Control 1.65E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg14439761)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.99E+00 Statistic Test p-value: 3.73E-03; Z-score: 1.04E+01

Methylation in Case

 1.81E-01 (Median) Methylation in Control 9.08E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A2 in lung adenocarcinoma [ 7 ]

Location

 TSS200 (cg02203420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 5.78E-03; Z-score: -4.65E+00

Methylation in Case

 7.79E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A2 in lung adenocarcinoma [ 7 ]

Location

 1stExon (cg12348970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 5.44E-03; Z-score: -3.66E+00

Methylation in Case

 8.37E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in panic disorder [ 8 ]

Location

 TSS1500 (cg14442421)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.39E-01 Statistic Test p-value: 1.15E-02; Z-score: -4.44E-01

Methylation in Case

 -3.70E+00 (Median) Methylation in Control -3.48E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in panic disorder [ 8 ]

Location

 Body (cg14414100)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 9.36E-04; Z-score: 4.45E-01

Methylation in Case

 1.51E+00 (Median) Methylation in Control 1.32E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg14442421)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 2.54E-05; Z-score: 7.91E-01

Methylation in Case

 1.01E-01 (Median) Methylation in Control 8.46E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in papillary thyroid cancer [ 9 ]

Location

 TSS1500 (cg14439761)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 5.05E-03; Z-score: 5.87E-01

Methylation in Case

 8.89E-02 (Median) Methylation in Control 7.97E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A2 in papillary thyroid cancer [ 9 ]

Location

 TSS200 (cg02203420)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.13E-05; Z-score: -9.96E-01

Methylation in Case

 8.89E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A2 in papillary thyroid cancer [ 9 ]

Location

 1stExon (cg12348970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.37E-06; Z-score: -1.13E+00

Methylation in Case

 9.22E-01 (Median) Methylation in Control 9.42E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A2 in papillary thyroid cancer [ 9 ]

Location

 Body (cg13661323)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 3.35E-09; Z-score: -1.99E+00

Methylation in Case

 8.91E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in prostate cancer [ 10 ]

Location

 TSS1500 (cg04399565)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 2.19E-02; Z-score: 1.66E+00

Methylation in Case

 8.75E-01 (Median) Methylation in Control 7.79E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in prostate cancer [ 10 ]

Location

 TSS200 (cg02804028)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 1.33E-02; Z-score: 2.20E+00

Methylation in Case

 8.17E-02 (Median) Methylation in Control 6.35E-02 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A2 in prostate cancer [ 10 ]

Location

 Body (cg08792812)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.98E+00 Statistic Test p-value: 7.36E-03; Z-score: -2.49E+00

Methylation in Case

 2.25E-01 (Median) Methylation in Control 4.45E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A2 in prostate cancer [ 10 ]

Location

 Body (cg04474257)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 2.59E-02; Z-score: 1.78E+00

Methylation in Case

 9.11E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A2 in prostate cancer [ 10 ]

Location

 Body (cg25453063)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.41E-02; Z-score: 1.50E+00

Methylation in Case

 9.53E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A2 in pancretic ductal adenocarcinoma [ 11 ]

Location

 TSS200 (cg18038666)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 2.26E-02; Z-score: -6.59E-01

Methylation in Case

 8.17E-02 (Median) Methylation in Control 9.11E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A2 in pancretic ductal adenocarcinoma [ 11 ]

Location

 Body (cg13507893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 1.47E-04; Z-score: 9.79E-01

Methylation in Case

 8.85E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          24 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-1277 directly targets SLC24A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1277 miRNA Mature ID miR-1277-5p

miRNA Sequence

 AAAUAUAUAUAUAUAUGUACGUAU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-142 directly targets SLC24A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-142 miRNA Mature ID miR-142-5p

miRNA Sequence

 CAUAAAGUAGAAAGCACUACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-190a directly targets SLC24A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-190a miRNA Mature ID miR-190a-3p

miRNA Sequence

 CUAUAUAUCAAACAUAUUCCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 4

 miR-29a directly targets SLC24A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-29a miRNA Mature ID miR-29a-5p

miRNA Sequence

 ACUGAUUUCUUUUGGUGUUCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-3142 directly targets SLC24A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3142 miRNA Mature ID miR-3142

miRNA Sequence

 AAGGCCUUUCUGAACCUUCAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-340 directly targets SLC24A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-340 miRNA Mature ID miR-340-5p

miRNA Sequence

 UUAUAAAGCAAUGAGACUGAUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-3922 directly targets SLC24A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3922 miRNA Mature ID miR-3922-5p

miRNA Sequence

 UCAAGGCCAGAGGUCCCACAGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-3924 directly targets SLC24A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3924 miRNA Mature ID miR-3924

miRNA Sequence

 AUAUGUAUAUGUGACUGCUACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-410 directly targets SLC24A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-410 miRNA Mature ID miR-410-3p

miRNA Sequence

 AAUAUAACACAGAUGGCCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-4474 directly targets SLC24A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4474 miRNA Mature ID miR-4474-5p

miRNA Sequence

 UUAGUCUCAUGAUCAGACACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-4490 directly targets SLC24A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4490 miRNA Mature ID miR-4490

miRNA Sequence

 UCUGGUAAGAGAUUUGGGCAUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-4672 directly targets SLC24A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4672 miRNA Mature ID miR-4672

miRNA Sequence

 UUACACAGCUGGACAGAGGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-4774 directly targets SLC24A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4774 miRNA Mature ID miR-4774-5p

miRNA Sequence

 UCUGGUAUGUAGUAGGUAAUAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 14

 miR-4775 directly targets SLC24A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4775 miRNA Mature ID miR-4775

miRNA Sequence

 UUAAUUUUUUGUUUCGGUCACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-4789 directly targets SLC24A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4789 miRNA Mature ID miR-4789-5p

miRNA Sequence

 GUAUACACCUGAUAUGUGUAUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-5011 directly targets SLC24A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5011 miRNA Mature ID miR-5011-5p

miRNA Sequence

 UAUAUAUACAGCCAUGCACUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-515 directly targets SLC24A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-515 miRNA Mature ID miR-515-5p

miRNA Sequence

 UUCUCCAAAAGAAAGCACUUUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-519d directly targets SLC24A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-519d miRNA Mature ID miR-519d-5p

miRNA Sequence

 CCUCCAAAGGGAAGCGCUUUCUGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-519e directly targets SLC24A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-519e miRNA Mature ID miR-519e-5p

miRNA Sequence

 UUCUCCAAAAGGGAGCACUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-5590 directly targets SLC24A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5590 miRNA Mature ID miR-5590-3p

miRNA Sequence

 AAUAAAGUUCAUGUAUGGCAA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 21

 miR-5695 directly targets SLC24A2 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5695 miRNA Mature ID miR-5695

miRNA Sequence

 ACUCCAAGAAGAAUCUAGACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-590 directly targets SLC24A2 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-590 miRNA Mature ID miR-590-3p

miRNA Sequence

 UAAUUUUAUGUAUAAGCUAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 23

 miR-6083 directly targets SLC24A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6083 miRNA Mature ID miR-6083

miRNA Sequence

 CUUAUAUCAGAGGCUGUGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 24

 miR-6768 directly targets SLC24A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6768 miRNA Mature ID miR-6768-5p

miRNA Sequence

 CACACAGGAAAAGCGGGGCCCUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 DNA Methylation Dynamics in Urological Tumors.
4 Genome-wide Scan for Methylation Profiles in Breast Cancer
5 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
12 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
13 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
14 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
15 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.