Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0164 Transporter Info
Gene Name SLC24A3
Transporter Name Sodium/potassium/calcium exchanger 3
Gene ID
57419
UniProt ID
Q9HC58
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg00350003)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.63E+00 Statistic Test p-value: 3.91E-05; Z-score: 1.09E+01

Methylation in Case

 2.53E-01 (Median) Methylation in Control 5.47E-02 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in colon adenocarcinoma [ 1 ]

Location

 TSS200 (cg19980771)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 5.62E-06; Z-score: 1.36E+00

Methylation in Case

 8.35E-01 (Median) Methylation in Control 6.83E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in colon adenocarcinoma [ 1 ]

Location

 Body (cg07262873)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 1.39E-04; Z-score: 1.33E+00

Methylation in Case

 4.82E-01 (Median) Methylation in Control 4.06E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A3 in colon adenocarcinoma [ 1 ]

Location

 Body (cg13806356)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 3.97E-04; Z-score: -1.21E+00

Methylation in Case

 4.37E-01 (Median) Methylation in Control 5.02E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A3 in colon adenocarcinoma [ 1 ]

Location

 Body (cg08848753)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 6.87E-04; Z-score: -1.42E+00

Methylation in Case

 9.50E-01 (Median) Methylation in Control 9.60E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A3 in colon adenocarcinoma [ 1 ]

Location

 Body (cg27649194)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.43E-03; Z-score: 7.80E-01

Methylation in Case

 5.84E-01 (Median) Methylation in Control 5.46E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg01352551)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 2.90E-05; Z-score: -3.74E+00

Methylation in Case

 6.09E-01 (Median) Methylation in Control 7.83E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg11755796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 3.24E-02; Z-score: 2.35E+00

Methylation in Case

 1.39E-01 (Median) Methylation in Control 1.19E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in bladder cancer [ 2 ]

Location

 Body (cg16172619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.39E+00 Statistic Test p-value: 3.97E-06; Z-score: -1.81E+01

Methylation in Case

 4.89E-01 (Median) Methylation in Control 6.79E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A3 in bladder cancer [ 2 ]

Location

 Body (cg13805533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 9.99E-06; Z-score: -1.35E+01

Methylation in Case

 7.05E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A3 in bladder cancer [ 2 ]

Location

 Body (cg02718002)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 3.82E-03; Z-score: -3.60E+00

Methylation in Case

 8.62E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A3 in bladder cancer [ 2 ]

Location

 3'UTR (cg19977363)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.83E-04; Z-score: -2.66E+00

Methylation in Case

 8.33E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in breast cancer [ 3 ]

Location

 TSS1500 (cg11755796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 1.23E-03; Z-score: 6.28E-01

Methylation in Case

 1.02E-01 (Median) Methylation in Control 8.83E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in breast cancer [ 3 ]

Location

 TSS1500 (cg01557989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 1.27E-03; Z-score: 7.95E-01

Methylation in Case

 6.76E-02 (Median) Methylation in Control 5.46E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in breast cancer [ 3 ]

Location

 Body (cg20194982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 2.53E-12; Z-score: 1.54E+00

Methylation in Case

 8.56E-01 (Median) Methylation in Control 7.85E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A3 in breast cancer [ 3 ]

Location

 Body (cg20244340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 2.65E-09; Z-score: -1.50E+00

Methylation in Case

 2.63E-01 (Median) Methylation in Control 3.22E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A3 in breast cancer [ 3 ]

Location

 Body (cg02718002)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.05E-05; Z-score: -9.60E-01

Methylation in Case

 8.83E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A3 in breast cancer [ 3 ]

Location

 Body (cg13805533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 1.96E-03; Z-score: -9.89E-01

Methylation in Case

 7.28E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC24A3 in breast cancer [ 3 ]

Location

 3'UTR (cg19977363)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.74E-03; Z-score: -6.00E-01

Methylation in Case

 8.75E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg27382790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.54E+00 Statistic Test p-value: 7.32E-06; Z-score: 1.50E+00

Methylation in Case

 1.07E-01 (Median) Methylation in Control 6.92E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg11755796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 6.72E-04; Z-score: 1.31E+00

Methylation in Case

 7.65E-02 (Median) Methylation in Control 5.74E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg01557989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.51E+00 Statistic Test p-value: 4.37E-03; Z-score: 1.21E+00

Methylation in Case

 3.27E-02 (Median) Methylation in Control 2.16E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg01352551)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.70E-02; Z-score: 4.05E-01

Methylation in Case

 9.03E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg15501281)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 4.40E-02; Z-score: 1.30E-01

Methylation in Case

 1.81E-02 (Median) Methylation in Control 1.71E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A3 in clear cell renal cell carcinoma [ 4 ]

Location

 1stExon (cg14887315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 2.28E-03; Z-score: 1.04E+00

Methylation in Case

 1.61E-02 (Median) Methylation in Control 1.41E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC24A3 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg00888479)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.39E+00 Statistic Test p-value: 1.28E-04; Z-score: 1.52E+00

Methylation in Case

 1.10E-01 (Median) Methylation in Control 7.92E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

          12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg11755796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.22E+00 Statistic Test p-value: 7.78E-09; Z-score: 4.08E+00

Methylation in Case

 1.47E-01 (Median) Methylation in Control 6.64E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg27382790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 1.25E-06; Z-score: 1.55E+00

Methylation in Case

 1.72E-01 (Median) Methylation in Control 1.39E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg01557989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 2.23E-06; Z-score: 1.47E+00

Methylation in Case

 1.20E-01 (Median) Methylation in Control 9.05E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg15501281)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.14E-05; Z-score: 2.26E-01

Methylation in Case

 2.23E-02 (Median) Methylation in Control 2.11E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 1stExon (cg14887315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 7.99E-04; Z-score: 9.21E-01

Methylation in Case

 1.59E-02 (Median) Methylation in Control 1.26E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 Body (cg16172619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 2.10E-09; Z-score: -3.13E+00

Methylation in Case

 7.51E-01 (Median) Methylation in Control 8.50E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 Body (cg00888479)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.35E+00 Statistic Test p-value: 2.67E-07; Z-score: 2.10E+00

Methylation in Case

 2.17E-01 (Median) Methylation in Control 1.61E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 Body (cg20244340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 1.81E-04; Z-score: 1.41E+00

Methylation in Case

 3.64E-01 (Median) Methylation in Control 2.87E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 Body (cg20194982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.27E-02; Z-score: -1.69E-01

Methylation in Case

 9.46E-01 (Median) Methylation in Control 9.48E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 Body (cg02718002)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.97E-02; Z-score: -4.70E-01

Methylation in Case

 9.47E-01 (Median) Methylation in Control 9.50E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 Body (cg13805533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.69E-02; Z-score: -3.21E-01

Methylation in Case

 8.71E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC24A3 in colorectal cancer [ 5 ]

Location

 3'UTR (cg19977363)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 1.56E-02; Z-score: 6.50E-03

Methylation in Case

 9.07E-01 (Median) Methylation in Control 9.07E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          12 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg00315391)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.55E+00 Statistic Test p-value: 4.07E-11; Z-score: 4.75E+00

Methylation in Case

 2.26E-01 (Median) Methylation in Control 8.88E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg27382790)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.70E+00 Statistic Test p-value: 2.40E-08; Z-score: 3.24E+00

Methylation in Case

 2.51E-01 (Median) Methylation in Control 1.48E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg15501281)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.37E+00 Statistic Test p-value: 3.52E-08; Z-score: 2.26E+00

Methylation in Case

 1.51E-01 (Median) Methylation in Control 4.50E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg01557989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.44E+00 Statistic Test p-value: 1.31E-07; Z-score: 2.48E+00

Methylation in Case

 1.39E-01 (Median) Methylation in Control 9.66E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg11755796)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.96E-05; Z-score: 1.79E-01

Methylation in Case

 1.33E-01 (Median) Methylation in Control 1.29E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg24890054)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 4.80E+00 Statistic Test p-value: 1.15E-11; Z-score: 5.78E+00

Methylation in Case

 3.65E-01 (Median) Methylation in Control 7.60E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 1stExon (cg14887315)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 3.94E-03; Z-score: 3.06E-01

Methylation in Case

 3.53E-02 (Median) Methylation in Control 3.21E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg11249835)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 2.05E-12; Z-score: -6.22E+00

Methylation in Case

 6.96E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg00888479)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.54E+00 Statistic Test p-value: 5.08E-07; Z-score: 3.79E+00

Methylation in Case

 2.38E-01 (Median) Methylation in Control 1.55E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg20244340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 1.96E-02; Z-score: -1.72E+00

Methylation in Case

 2.12E-01 (Median) Methylation in Control 2.79E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 3'UTR (cg14491707)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 9.62E-19; Z-score: -3.83E+00

Methylation in Case

 3.21E-01 (Median) Methylation in Control 4.52E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 12

 Methylation of SLC24A3 in hepatocellular carcinoma [ 6 ]

Location

 3'UTR (cg00079485)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.90E-11; Z-score: -4.79E+00

Methylation in Case

 6.16E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg01557989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 2.39E-02; Z-score: 2.06E+00

Methylation in Case

 1.12E-01 (Median) Methylation in Control 8.94E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg15501281)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.91E+00 Statistic Test p-value: 3.32E-02; Z-score: 4.12E+00

Methylation in Case

 7.11E-02 (Median) Methylation in Control 3.73E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in lung adenocarcinoma [ 7 ]

Location

 Body (cg13805533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 3.22E-03; Z-score: -3.10E+00

Methylation in Case

 7.68E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A3 in lung adenocarcinoma [ 7 ]

Location

 Body (cg16172619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 2.87E-02; Z-score: 1.24E+00

Methylation in Case

 7.35E-01 (Median) Methylation in Control 6.90E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A3 in lung adenocarcinoma [ 7 ]

Location

 Body (cg00888479)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.34E+00 Statistic Test p-value: 3.06E-02; Z-score: 2.51E+00

Methylation in Case

 2.37E-01 (Median) Methylation in Control 1.78E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in prostate cancer [ 8 ]

Location

 TSS1500 (cg01826863)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.52E-02; Z-score: 2.21E+00

Methylation in Case

 1.84E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in prostate cancer [ 8 ]

Location

 TSS1500 (cg05895666)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.66E+00 Statistic Test p-value: 3.39E-02; Z-score: -1.61E+00

Methylation in Case

 7.68E-02 (Median) Methylation in Control 1.28E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in prostate cancer [ 8 ]

Location

 TSS200 (cg21017569)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.27E+00 Statistic Test p-value: 1.11E-03; Z-score: 6.17E+00

Methylation in Case

 8.46E-01 (Median) Methylation in Control 6.66E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg15992711)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 2.21E-09; Z-score: -1.57E+00

Methylation in Case

 3.92E-01 (Median) Methylation in Control 4.33E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg19347288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 8.31E-05; Z-score: -8.43E-01

Methylation in Case

 7.41E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg00588853)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.61E+00 Statistic Test p-value: 9.02E-05; Z-score: -1.48E+00

Methylation in Case

 1.18E-01 (Median) Methylation in Control 3.08E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A3 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg20651644)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.93E-04; Z-score: -1.16E+00

Methylation in Case

 7.60E-01 (Median) Methylation in Control 8.40E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A3 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg21399428)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 3.46E-04; Z-score: 8.75E-01

Methylation in Case

 8.37E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in panic disorder [ 10 ]

Location

 Body (cg13805533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 6.15E-04; Z-score: 4.50E-01

Methylation in Case

 3.18E+00 (Median) Methylation in Control 3.04E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in panic disorder [ 10 ]

Location

 Body (cg16172619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.62E-02; Z-score: 4.12E-01

Methylation in Case

 2.53E+00 (Median) Methylation in Control 2.41E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in panic disorder [ 10 ]

Location

 Body (cg02718002)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 3.71E-02; Z-score: 4.17E-01

Methylation in Case

 3.66E+00 (Median) Methylation in Control 3.56E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg00888479)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 1.31E-05; Z-score: 1.17E+00

Methylation in Case

 8.12E-02 (Median) Methylation in Control 6.19E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg13805533)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.06E-04; Z-score: -7.33E-01

Methylation in Case

 8.43E-01 (Median) Methylation in Control 8.63E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg20194982)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.55E-03; Z-score: -3.18E-01

Methylation in Case

 9.42E-01 (Median) Methylation in Control 9.47E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC24A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg16172619)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.93E-02; Z-score: -1.85E-02

Methylation in Case

 8.23E-01 (Median) Methylation in Control 8.24E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC24A3 in papillary thyroid cancer [ 11 ]

Location

 Body (cg20244340)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 4.46E-02; Z-score: 8.06E-01

Methylation in Case

 1.65E-01 (Median) Methylation in Control 1.35E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC24A3 in papillary thyroid cancer [ 11 ]

Location

 3'UTR (cg19977363)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.69E-03; Z-score: -7.40E-01

Methylation in Case

 8.70E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7c directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 let-7c miRNA Mature ID let-7c-3p

miRNA Sequence

 CUGUACAACCUUCUAGCUUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-3177 directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3177 miRNA Mature ID miR-3177-5p

miRNA Sequence

 UGUGUACACACGUGCCAGGCGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-4475 directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4475 miRNA Mature ID miR-4475

miRNA Sequence

 CAAGGGACCAAGCAUUCAUUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-4668 directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4668 miRNA Mature ID miR-4668-5p

miRNA Sequence

 AGGGAAAAAAAAAAGGAUUUGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-511 directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-511 miRNA Mature ID miR-511-3p

miRNA Sequence

 AAUGUGUAGCAAAAGACAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-548aa directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548aa miRNA Mature ID miR-548aa

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-548t directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548t miRNA Mature ID miR-548t-3p

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-5584 directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5584 miRNA Mature ID miR-5584-5p

miRNA Sequence

 CAGGGAAAUGGGAAGAACUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-624 directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-624 miRNA Mature ID miR-624-3p

miRNA Sequence

 CACAAGGUAUUGGUAUUACCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-7845 directly targets SLC24A3 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7845 miRNA Mature ID miR-7845-5p

miRNA Sequence

 AAGGGACAGGGAGGGUCGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
12 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.