Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0165 Transporter Info
Gene Name SLC24A4
Transporter Name Sodium/potassium/calcium exchanger 4
Gene ID
123041
UniProt ID
Q8NFF2
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A4 in bladder cancer [ 1 ]

Location

 TSS1500 (cg07031872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 1.10E-05; Z-score: -4.91E+00

Methylation in Case

 3.41E-01 (Median) Methylation in Control 5.21E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A4 in bladder cancer [ 1 ]

Location

 TSS1500 (cg12159314)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.80E+00 Statistic Test p-value: 1.93E-05; Z-score: -3.99E+00

Methylation in Case

 2.14E-01 (Median) Methylation in Control 3.84E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A4 in breast cancer [ 2 ]

Location

 TSS1500 (cg12159314)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 7.40E-08; Z-score: -1.63E+00

Methylation in Case

 4.36E-01 (Median) Methylation in Control 5.16E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A4 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg24195486)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.50E+00 Statistic Test p-value: 2.90E-06; Z-score: 2.87E+00

Methylation in Case

 4.39E-01 (Median) Methylation in Control 2.93E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A4 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg07031872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 8.83E-03; Z-score: 1.04E+00

Methylation in Case

 5.86E-01 (Median) Methylation in Control 5.34E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A4 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg12159314)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.22E+00 Statistic Test p-value: 1.13E-02; Z-score: 1.79E+00

Methylation in Case

 4.41E-01 (Median) Methylation in Control 3.62E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A4 in colon adenocarcinoma [ 4 ]

Location

 TSS1500 (cg16729160)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.67E+00 Statistic Test p-value: 1.70E-03; Z-score: 2.46E+00

Methylation in Case

 1.46E-01 (Median) Methylation in Control 8.72E-02 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A4 in colon adenocarcinoma [ 4 ]

Location

 TSS200 (cg26230285)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.32E+00 Statistic Test p-value: 2.86E-06; Z-score: 1.29E+00

Methylation in Case

 6.38E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A4 in colon adenocarcinoma [ 4 ]

Location

 1stExon (cg24933645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.84E+00 Statistic Test p-value: 1.31E-03; Z-score: 2.41E+00

Methylation in Case

 3.77E-01 (Median) Methylation in Control 2.04E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg07031872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 3.33E-06; Z-score: -1.80E+00

Methylation in Case

 3.79E-01 (Median) Methylation in Control 4.95E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A4 in hepatocellular carcinoma [ 5 ]

Location

 TSS1500 (cg24195486)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 2.66E-05; Z-score: -1.55E+00

Methylation in Case

 3.31E-01 (Median) Methylation in Control 4.25E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC24A4 in hepatocellular carcinoma [ 5 ]

Location

 3'UTR (cg07046101)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.75E+00 Statistic Test p-value: 6.57E-22; Z-score: -3.74E+00

Methylation in Case

 2.68E-01 (Median) Methylation in Control 4.69E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A4 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg07031872)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 9.57E-04; Z-score: 2.83E+00

Methylation in Case

 6.74E-01 (Median) Methylation in Control 5.72E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A4 in lung adenocarcinoma [ 6 ]

Location

 TSS1500 (cg24195486)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 1.79E-03; Z-score: 2.68E+00

Methylation in Case

 5.55E-01 (Median) Methylation in Control 4.29E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A4 in papillary thyroid cancer [ 7 ]

Location

 TSS1500 (cg12159314)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.28E+00 Statistic Test p-value: 2.29E-03; Z-score: -1.34E+00

Methylation in Case

 2.98E-01 (Median) Methylation in Control 3.82E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC24A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

 TSS200 (cg21609339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.66E+00 Statistic Test p-value: 2.67E-34; Z-score: 5.97E+00

Methylation in Case

 4.09E-01 (Median) Methylation in Control 2.46E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC24A4 in pancretic ductal adenocarcinoma [ 8 ]

Location

 Body (cg06399135)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 4.68E-02; Z-score: -6.01E-01

Methylation in Case

 3.24E-01 (Median) Methylation in Control 3.80E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Posterior fossa ependymoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC24A4 in posterior fossa ependymoma than that in healthy individual

Studied Phenotype

 Posterior fossa ependymoma [ICD-11:2D50.2]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.51E-31; Fold-change: -0.293272513; Z-score: -1.480604431
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Atypical teratoid rhabdoid tumour

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC24A4 in atypical teratoid rhabdoid tumour than that in healthy individual

Studied Phenotype

 Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 5.28E-11; Fold-change: 0.369033663; Z-score: 1.737754544
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Third ventricle chordoid glioma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC24A4 in third ventricle chordoid glioma than that in healthy individual

Studied Phenotype

 Third ventricle chordoid glioma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.002597994; Fold-change: 0.499831732; Z-score: 1.395004734
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Squamous cell carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Moderate hypomethylation of SLC24A4 in squamous cell carcinoma than that in adjacent tissue

Studied Phenotype

 Squamous cell carcinoma [ICD-11:2B60]

The Methylation Level of Disease Section Compare with the Adjacent Tissue

 p-value: 0.000450496; Fold-change: -0.206546904; Z-score: -2.845257313
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue adjacent to the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section
Download DT methylation data in the tissue of healthy individual

microRNA

  Unclear Phenotype

        103 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-10a directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

 UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-10b directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-10b miRNA Mature ID miR-10b-5p

miRNA Sequence

 UACCCUGUAGAACCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-1247 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1247 miRNA Mature ID miR-1247-3p

miRNA Sequence

 CCCCGGGAACGUCGAGACUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1270 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1270 miRNA Mature ID miR-1270

miRNA Sequence

 CUGGAGAUAUGGAAGAGCUGUGU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 5

 miR-1285 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1285 miRNA Mature ID miR-1285-3p

miRNA Sequence

 UCUGGGCAACAAAGUGAGACCU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 6

 miR-1292 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1292 miRNA Mature ID miR-1292-3p

miRNA Sequence

 UCGCGCCCCGGCUCCCGUUC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 7

 miR-1324 directly targets SLC24A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1324 miRNA Mature ID miR-1324

miRNA Sequence

 CCAGACAGAAUUCUAUGCACUUUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-140 directly targets SLC24A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-140 miRNA Mature ID miR-140-3p

miRNA Sequence

 UACCACAGGGUAGAACCACGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-1827 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1827 miRNA Mature ID miR-1827

miRNA Sequence

 UGAGGCAGUAGAUUGAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-183 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-183 miRNA Mature ID miR-183-5p

miRNA Sequence

 UAUGGCACUGGUAGAAUUCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-18b directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-18b miRNA Mature ID miR-18b-3p

miRNA Sequence

 UGCCCUAAAUGCCCCUUCUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-196a directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-196a miRNA Mature ID miR-196a-3p

miRNA Sequence

 CGGCAACAAGAAACUGCCUGAG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 13

 miR-20b directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-20b miRNA Mature ID miR-20b-3p

miRNA Sequence

 ACUGUAGUAUGGGCACUUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-2114 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2114 miRNA Mature ID miR-2114-5p

miRNA Sequence

 UAGUCCCUUCCUUGAAGCGGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-2467 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-2467 miRNA Mature ID miR-2467-5p

miRNA Sequence

 UGAGGCUCUGUUAGCCUUGGCUC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 16

 miR-27b directly targets SLC24A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-27b miRNA Mature ID miR-27b-5p

miRNA Sequence

 AGAGCUUAGCUGAUUGGUGAAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 17

 miR-3166 directly targets SLC24A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3166 miRNA Mature ID miR-3166

miRNA Sequence

 CGCAGACAAUGCCUACUGGCCUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 18

 miR-3187 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3187 miRNA Mature ID miR-3187-5p

miRNA Sequence

 CCUGGGCAGCGUGUGGCUGAAGG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 19

 miR-3188 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3188 miRNA Mature ID miR-3188

miRNA Sequence

 AGAGGCUUUGUGCGGAUACGGGG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 20

 miR-339 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-339 miRNA Mature ID miR-339-5p

miRNA Sequence

 UCCCUGUCCUCCAGGAGCUCACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-3613 directly targets SLC24A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3613 miRNA Mature ID miR-3613-3p

miRNA Sequence

 ACAAAAAAAAAAGCCCAACCCUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-3664 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3664 miRNA Mature ID miR-3664-3p

miRNA Sequence

 UCUCAGGAGUAAAGACAGAGUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-371a directly targets SLC24A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-371a miRNA Mature ID miR-371a-5p

miRNA Sequence

 ACUCAAACUGUGGGGGCACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-371b directly targets SLC24A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-371b miRNA Mature ID miR-371b-5p

miRNA Sequence

 ACUCAAAAGAUGGCGGCACUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-372 directly targets SLC24A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-372 miRNA Mature ID miR-372-5p

miRNA Sequence

 CCUCAAAUGUGGAGCACUAUUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-373 directly targets SLC24A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-373 miRNA Mature ID miR-373-5p

miRNA Sequence

 ACUCAAAAUGGGGGCGCUUUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-377 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

 AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-3914 directly targets SLC24A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3914 miRNA Mature ID miR-3914

miRNA Sequence

 AAGGAACCAGAAAAUGAGAAGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-3975 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3975 miRNA Mature ID miR-3975

miRNA Sequence

 UGAGGCUAAUGCACUACUUCAC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 30

 miR-4252 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4252 miRNA Mature ID miR-4252

miRNA Sequence

 GGCCACUGAGUCAGCACCA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 31

 miR-4302 directly targets SLC24A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4302 miRNA Mature ID miR-4302

miRNA Sequence

 CCAGUGUGGCUCAGCGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 32

 miR-4310 directly targets SLC24A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4310 miRNA Mature ID miR-4310

miRNA Sequence

 GCAGCAUUCAUGUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-4316 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4316 miRNA Mature ID miR-4316

miRNA Sequence

 GGUGAGGCUAGCUGGUG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 34

 miR-4421 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4421 miRNA Mature ID miR-4421

miRNA Sequence

 ACCUGUCUGUGGAAAGGAGCUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-4426 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4426 miRNA Mature ID miR-4426

miRNA Sequence

 GAAGAUGGACGUACUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-4509 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4509 miRNA Mature ID miR-4509

miRNA Sequence

 ACUAAAGGAUAUAGAAGGUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-455 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

 GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-4647 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4647 miRNA Mature ID miR-4647

miRNA Sequence

 GAAGAUGGUGCUGUGCUGAGGAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-4649 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4649 miRNA Mature ID miR-4649-3p

miRNA Sequence

 UCUGAGGCCUGCCUCUCCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-4662b directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4662b miRNA Mature ID miR-4662b

miRNA Sequence

 AAAGAUGGACAAUUGGCUAAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 41

 miR-4668 directly targets SLC24A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4668 miRNA Mature ID miR-4668-5p

miRNA Sequence

 AGGGAAAAAAAAAAGGAUUUGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-4683 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4683 miRNA Mature ID miR-4683

miRNA Sequence

 UGGAGAUCCAGUGCUCGCCCGAU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 43

 miR-4695 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4695 miRNA Mature ID miR-4695-5p

miRNA Sequence

 CAGGAGGCAGUGGGCGAGCAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-4722 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-5p

miRNA Sequence

 GGCAGGAGGGCUGUGCCAGGUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 45

 miR-4733 directly targets SLC24A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4733 miRNA Mature ID miR-4733-5p

miRNA Sequence

 AAUCCCAAUGCUAGACCCGGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 46

 miR-4768 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-3p

miRNA Sequence

 CCAGGAGAUCCAGAGAGAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-4793 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4793 miRNA Mature ID miR-4793-3p

miRNA Sequence

 UCUGCACUGUGAGUUGGCUGGCU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 48

 miR-4797 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4797 miRNA Mature ID miR-4797-5p

miRNA Sequence

 GACAGAGUGCCACUUACUGAA

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 49

 miR-485 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-485 miRNA Mature ID miR-485-5p

miRNA Sequence

 AGAGGCUGGCCGUGAUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 50

 miR-5008 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5008 miRNA Mature ID miR-5008-5p

miRNA Sequence

 UGAGGCCCUUGGGGCACAGUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-508 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-508 miRNA Mature ID miR-508-5p

miRNA Sequence

 UACUCCAGAGGGCGUCACUCAUG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 52

 miR-510 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-510 miRNA Mature ID miR-510-3p

miRNA Sequence

 AUUGAAACCUCUAAGAGUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 53

 miR-510 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-510 miRNA Mature ID miR-510-5p

miRNA Sequence

 UACUCAGGAGAGUGGCAAUCAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 54

 miR-5189 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5189 miRNA Mature ID miR-5189-5p

miRNA Sequence

 UCUGGGCACAGGCGGAUGGACAGG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 55

 miR-5197 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5197 miRNA Mature ID miR-5197-5p

miRNA Sequence

 CAAUGGCACAAACUCAUUCUUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-548aa directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548aa miRNA Mature ID miR-548aa

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-548ap directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548ap miRNA Mature ID miR-548ap-3p

miRNA Sequence

 AAAAACCACAAUUACUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 58

 miR-548as directly targets SLC24A4 [ 16 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-548as miRNA Mature ID miR-548as-3p

miRNA Sequence

 UAAAACCCACAAUUAUGUUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 59

 miR-548at directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548at miRNA Mature ID miR-548at-3p

miRNA Sequence

 CAAAACCGCAGUAACUUUUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 60

 miR-548ay directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548ay miRNA Mature ID miR-548ay-3p

miRNA Sequence

 CAAAACCGCGAUUACUCUUGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 61

 miR-548t directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-548t miRNA Mature ID miR-548t-3p

miRNA Sequence

 AAAAACCACAAUUACUUUUGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 62

 miR-556 directly targets SLC24A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-556 miRNA Mature ID miR-556-5p

miRNA Sequence

 GAUGAGCUCAUUGUAAUAUGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 63

 miR-5586 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5586 miRNA Mature ID miR-5586-3p

miRNA Sequence

 CAGAGUGACAAGCUGGUUAAAG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 64

 miR-5588 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5588 miRNA Mature ID miR-5588-3p

miRNA Sequence

 AAGUCCCACUAAUGCCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 65

 miR-561 directly targets SLC24A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-561 miRNA Mature ID miR-561-5p

miRNA Sequence

 AUCAAGGAUCUUAAACUUUGCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 66

 miR-5690 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5690 miRNA Mature ID miR-5690

miRNA Sequence

 UCAGCUACUACCUCUAUUAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 67

 miR-5699 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5699 miRNA Mature ID miR-5699-3p

miRNA Sequence

 UCCUGUCUUUCCUUGUUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 68

 miR-593 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-593 miRNA Mature ID miR-593-5p

miRNA Sequence

 AGGCACCAGCCAGGCAUUGCUCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 69

 miR-6086 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6086 miRNA Mature ID miR-6086

miRNA Sequence

 GGAGGUUGGGAAGGGCAGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 70

 miR-6089 directly targets SLC24A4 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6089 miRNA Mature ID miR-6089

miRNA Sequence

 GGAGGCCGGGGUGGGGCGGGGCGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 71

 miR-612 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-612 miRNA Mature ID miR-612

miRNA Sequence

 GCUGGGCAGGGCUUCUGAGCUCCUU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 72

 miR-616 directly targets SLC24A4 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-616 miRNA Mature ID miR-616-5p

miRNA Sequence

 ACUCAAAACCCUUCAGUGACUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 73

 miR-620 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-620 miRNA Mature ID miR-620

miRNA Sequence

 AUGGAGAUAGAUAUAGAAAU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 74

 miR-6499 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

 AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 75

 miR-6512 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6512 miRNA Mature ID miR-6512-3p

miRNA Sequence

 UUCCAGCCCUUCUAAUGGUAGG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 76

 miR-6516 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6516 miRNA Mature ID miR-6516-5p

miRNA Sequence

 UUUGCAGUAACAGGUGUGAGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 77

 miR-658 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-658 miRNA Mature ID miR-658

miRNA Sequence

 GGCGGAGGGAAGUAGGUCCGUUGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 78

 miR-661 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-661 miRNA Mature ID miR-661

miRNA Sequence

 UGCCUGGGUCUCUGGCCUGCGCGU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 79

 miR-665 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-665 miRNA Mature ID miR-665

miRNA Sequence

 ACCAGGAGGCUGAGGCCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 80

 miR-6720 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6720 miRNA Mature ID miR-6720-5p

miRNA Sequence

 UUCCAGCCCUGGUAGGCGCCGCG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 81

 miR-6720 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6720 miRNA Mature ID miR-6720-3p

miRNA Sequence

 CGCGCCUGCAGGAACUGGUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 82

 miR-6746 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6746 miRNA Mature ID miR-6746-5p

miRNA Sequence

 CCGGGAGAAGGAGGUGGCCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 83

 miR-6771 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6771 miRNA Mature ID miR-6771-5p

miRNA Sequence

 CUCGGGAGGGCAUGGGCCAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 84

 miR-6776 directly targets SLC24A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6776 miRNA Mature ID miR-6776-3p

miRNA Sequence

 CAACCACCACUGUCUCUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 85

 miR-6801 directly targets SLC24A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6801 miRNA Mature ID miR-6801-5p

miRNA Sequence

 UGGUCAGAGGCAGCAGGAAAUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 86

 miR-6807 directly targets SLC24A4 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6807 miRNA Mature ID miR-6807-5p

miRNA Sequence

 GUGAGCCAGUGGAAUGGAGAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 87

 miR-6808 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6808 miRNA Mature ID miR-6808-5p

miRNA Sequence

 CAGGCAGGGAGGUGGGACCAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 88

 miR-6828 directly targets SLC24A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6828 miRNA Mature ID miR-6828-5p

miRNA Sequence

 AGGAAGCAAGAGAACCCUGUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 89

 miR-6830 directly targets SLC24A4 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6830 miRNA Mature ID miR-6830-5p

miRNA Sequence

 CCAAGGAAGGAGGCUGGACAUC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 90

 miR-6849 directly targets SLC24A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6849 miRNA Mature ID miR-6849-3p

miRNA Sequence

 ACCAGCCUGUGUCCACCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 91

 miR-6851 directly targets SLC24A4 [ 17 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6851 miRNA Mature ID miR-6851-3p

miRNA Sequence

 UGGCCCUUUGUACCCCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 92

 miR-6860 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6860 miRNA Mature ID miR-6860

miRNA Sequence

 ACUGGGCAGGGCUGUGGUGAGU

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 93

 miR-6884 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6884 miRNA Mature ID miR-6884-5p

miRNA Sequence

 AGAGGCUGAGAAGGUGAUGUUG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 94

 miR-6893 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6893 miRNA Mature ID miR-6893-5p

miRNA Sequence

 CAGGCAGGUGUAGGGUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 95

 miR-7157 directly targets SLC24A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-7157 miRNA Mature ID miR-7157-5p

miRNA Sequence

 UCAGCAUUCAUUGGCACCAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 96

 miR-759 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-759 miRNA Mature ID miR-759

miRNA Sequence

 GCAGAGUGCAAACAAUUUUGAC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 97

 miR-766 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-766 miRNA Mature ID miR-766-3p

miRNA Sequence

 ACUCCAGCCCCACAGCCUCAGC

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 98

 miR-7703 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7703 miRNA Mature ID miR-7703

miRNA Sequence

 UUGCACUCUGGCCUUCUCCCAGG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 99

 miR-7977 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7977 miRNA Mature ID miR-7977

miRNA Sequence

 UUCCCAGCCAACGCACCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 100

 miR-873 directly targets SLC24A4 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-873 miRNA Mature ID miR-873-5p

miRNA Sequence

 GCAGGAACUUGUGAGUCUCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 101

 miR-939 directly targets SLC24A4 [ 11 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-939 miRNA Mature ID miR-939-3p

miRNA Sequence

 CCCUGGGCCUCUGCUCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Left ventricular cardiac tissues of human

  Epigenetic Phenomenon 102

 miR-940 directly targets SLC24A4 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-940 miRNA Mature ID miR-940

miRNA Sequence

 AAGGCAGGGCCCCCGCUCCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 103

 miR-944 directly targets SLC24A4 [ 14 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-944 miRNA Mature ID miR-944

miRNA Sequence

 AAAUUAUUGUACAUCGGAUGAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
9 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
10 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
11 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
12 Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
13 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.
14 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
15 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
16 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
17 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.