Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0167 Transporter Info
Gene Name SLC25A1
Transporter Name Tricarboxylate transport protein
Gene ID
6576
UniProt ID
P53007
Epigenetic Regulations of This DT (EGR)

Methylation

  Colon cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A1 in colon adenocarcinoma [ 1 ]

Location

 5'UTR (cg00549412)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 6.03E-04; Z-score: -1.44E+00

Methylation in Case

 5.57E-01 (Median) Methylation in Control 6.08E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A1 in colon adenocarcinoma [ 1 ]

Location

 Body (cg12913587)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.56E-03; Z-score: -1.57E+00

Methylation in Case

 8.27E-01 (Median) Methylation in Control 8.78E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

 5'UTR (cg14431850)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 8.15E-21; Z-score: -2.96E+00

Methylation in Case

 8.02E-01 (Median) Methylation in Control 8.77E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A1 in pancretic ductal adenocarcinoma [ 2 ]

Location

 3'UTR (cg08828816)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.94E-02; Z-score: 6.11E-01

Methylation in Case

 6.96E-01 (Median) Methylation in Control 6.51E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A1 in bladder cancer [ 3 ]

Location

 TSS1500 (cg12167239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 9.66E-04; Z-score: -2.33E+00

Methylation in Case

 5.94E-02 (Median) Methylation in Control 7.92E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A1 in bladder cancer [ 3 ]

Location

 TSS1500 (cg17887427)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 2.32E-02; Z-score: -1.28E+00

Methylation in Case

 5.62E-02 (Median) Methylation in Control 6.34E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A1 in bladder cancer [ 3 ]

Location

 Body (cg03917521)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 1.10E-02; Z-score: -1.66E+00

Methylation in Case

 1.08E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A1 in bladder cancer [ 3 ]

Location

 Body (cg00747849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 4.19E-02; Z-score: -1.65E+00

Methylation in Case

 1.70E-01 (Median) Methylation in Control 2.11E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg17887427)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 3.74E-03; Z-score: 5.87E-01

Methylation in Case

 1.75E-02 (Median) Methylation in Control 1.54E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A1 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg20336580)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 3.45E-02; Z-score: 2.13E-01

Methylation in Case

 1.17E-02 (Median) Methylation in Control 1.14E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A1 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg00747849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 1.01E-02; Z-score: 1.02E+00

Methylation in Case

 2.32E-01 (Median) Methylation in Control 1.86E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A1 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg17887427)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 4.66E-04; Z-score: 9.70E-01

Methylation in Case

 8.18E-02 (Median) Methylation in Control 7.01E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A1 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg05133900)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.42E-02; Z-score: 3.82E-01

Methylation in Case

 1.25E-01 (Median) Methylation in Control 1.20E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A1 in colorectal cancer [ 5 ]

Location

 TSS200 (cg20336580)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 3.35E-02; Z-score: 4.97E-01

Methylation in Case

 8.85E-03 (Median) Methylation in Control 7.87E-03 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A1 in colorectal cancer [ 5 ]

Location

 Body (cg26795923)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.51E+00 Statistic Test p-value: 1.96E-03; Z-score: -1.13E+00

Methylation in Case

 4.53E-02 (Median) Methylation in Control 6.82E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A1 in colorectal cancer [ 5 ]

Location

 Body (cg00747849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 4.62E-02; Z-score: 5.71E-01

Methylation in Case

 2.91E-01 (Median) Methylation in Control 2.60E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A1 in colorectal cancer [ 5 ]

Location

 3'UTR (cg17274357)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.62E-02; Z-score: -6.31E-01

Methylation in Case

 7.36E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A1 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg12167239)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.02E+00 Statistic Test p-value: 1.12E-12; Z-score: -1.80E+00

Methylation in Case

 7.50E-02 (Median) Methylation in Control 1.52E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A1 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg17887427)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.98E+00 Statistic Test p-value: 4.15E-11; Z-score: -2.14E+00

Methylation in Case

 7.15E-02 (Median) Methylation in Control 1.41E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A1 in prostate cancer [ 7 ]

Location

 TSS1500 (cg14777768)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.71E+00 Statistic Test p-value: 6.20E-06; Z-score: 1.07E+01

Methylation in Case

 6.45E-01 (Median) Methylation in Control 2.38E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A1 in prostate cancer [ 7 ]

Location

 TSS200 (cg27320005)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 3.47E-02; Z-score: 1.64E+00

Methylation in Case

 7.53E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Breast cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A1 in breast cancer [ 8 ]

Location

 TSS200 (cg07638904)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 4.20E-02; Z-score: 5.21E-01

Methylation in Case

 1.62E-02 (Median) Methylation in Control 1.26E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A1 in breast cancer [ 8 ]

Location

 3'UTR (cg02655711)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 2.91E-09; Z-score: 1.66E+00

Methylation in Case

 6.47E-01 (Median) Methylation in Control 5.44E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A1 in breast cancer [ 8 ]

Location

 3'UTR (cg17274357)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 2.02E-07; Z-score: 1.70E+00

Methylation in Case

 5.89E-01 (Median) Methylation in Control 5.37E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A1 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg00747849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 9.74E-07; Z-score: -1.22E+00

Methylation in Case

 1.91E-01 (Median) Methylation in Control 2.34E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A1 in hepatocellular carcinoma [ 9 ]

Location

 3'UTR (cg17274357)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.04E-06; Z-score: -8.57E-01

Methylation in Case

 6.40E-01 (Median) Methylation in Control 6.76E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A1 in hepatocellular carcinoma [ 9 ]

Location

 3'UTR (cg02655711)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.14E-02; Z-score: -2.97E-01

Methylation in Case

 4.91E-01 (Median) Methylation in Control 5.22E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7b directly targets SLC25A1 [ 10 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 let-7c directly targets SLC25A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 let-7c miRNA Mature ID let-7c-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUAUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-1-3p directly targets SLC25A1 [ 12 ]

Epigenetic Type

 microRNA Experiment Method Proteomics;Microarray

miRNA Stemloop ID

 miR-1-3p miRNA Mature ID miR-1-3p

miRNA Sequence

 UGGAAUGUAAAGAAGUAUGUAU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 4

 miR-125b directly targets SLC25A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-125b miRNA Mature ID miR-125b-5p

miRNA Sequence

 UCCCUGAGACCCUAACUUGUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-296 directly targets SLC25A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-296 miRNA Mature ID miR-296-3p

miRNA Sequence

 GAGGGUUGGGUGGAGGCUCUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-324 directly targets SLC25A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-324 miRNA Mature ID miR-324-3p

miRNA Sequence

 CCCACUGCCCCAGGUGCUGCUGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-335 directly targets SLC25A1 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-615 directly targets SLC25A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-615 miRNA Mature ID miR-615-3p

miRNA Sequence

 UCCGAGCCUGGGUCUCCCUCUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 9

 miR-744 directly targets SLC25A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-744 miRNA Mature ID miR-744-5p

miRNA Sequence

 UGCGGGGCUAGGGCUAACAGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-877 directly targets SLC25A1 [ 11 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-877 miRNA Mature ID miR-877-5p

miRNA Sequence

 GUAGAGGAGAUGGCGCAGGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3 DNA Methylation Dynamics in Urological Tumors.
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
8 Genome-wide Scan for Methylation Profiles in Breast Cancer
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
11 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
12 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
13 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.