Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0169 Transporter Info | ||||
Gene Name | SLC25A11 | ||||
Transporter Name | Mitochondrial 2-oxoglutarate/malate carrier | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-3176 directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3176 | miRNA Mature ID | miR-3176 | ||
miRNA Sequence |
ACUGGCCUGGGACUACCGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-3190 directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3190 | miRNA Mature ID | miR-3190-5p | ||
miRNA Sequence |
UCUGGCCAGCUACGUCCCCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-3922 directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3922 | miRNA Mature ID | miR-3922-3p | ||
miRNA Sequence |
UCUGGCCUUGACUUGACUCUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-4743 directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4743 | miRNA Mature ID | miR-4743-5p | ||
miRNA Sequence |
UGGCCGGAUGGGACAGGAGGCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-548ae directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548ae | miRNA Mature ID | miR-548ae-3p | ||
miRNA Sequence |
CAAAAACUGCAAUUACUUUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-548ah directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548ah | miRNA Mature ID | miR-548ah-3p | ||
miRNA Sequence |
CAAAAACUGCAGUUACUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-548aj directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548aj | miRNA Mature ID | miR-548aj-3p | ||
miRNA Sequence |
UAAAAACUGCAAUUACUUUUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-548am directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548am | miRNA Mature ID | miR-548am-3p | ||
miRNA Sequence |
CAAAAACUGCAGUUACUUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-548aq directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548aq | miRNA Mature ID | miR-548aq-3p | ||
miRNA Sequence |
CAAAAACUGCAAUUACUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-548j directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548j | miRNA Mature ID | miR-548j-3p | ||
miRNA Sequence |
CAAAAACUGCAUUACUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-548x directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-548x | miRNA Mature ID | miR-548x-3p | ||
miRNA Sequence |
UAAAAACUGCAAUUACUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-5582 directly targets SLC25A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5582 | miRNA Mature ID | miR-5582-3p | ||
miRNA Sequence |
UAAAACUUUAAGUGUGCCUAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Methylation |
|||||
References | |||||
---|---|---|---|---|---|
1 | Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32. | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.