Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0170 Transporter Info
Gene Name	SLC25A12
Transporter Name	Calcium-binding mitochondrial carrier protein Aralar1
Gene ID	8604
UniProt ID	O75746

Epigenetic Regulations of This DT (EGR)
Methylation
Hepatocellular carcinoma	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	TSS1500 (cg08856772)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 9.54E-06; Z-score: 5.25E-02
Methylation in Case	7.22E-02 (Median)	Methylation in Control	7.14E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	TSS1500 (cg03539474)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.58E-05; Z-score: 6.84E-01
Methylation in Case	5.91E-02 (Median)	Methylation in Control	5.17E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	TSS1500 (cg27230724)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.95E-05; Z-score: 5.98E-01
Methylation in Case	8.94E-02 (Median)	Methylation in Control	8.40E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	TSS200 (cg07751764)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 3.77E-10; Z-score: -1.39E+00
Methylation in Case	4.04E-01 (Median)	Methylation in Control	5.25E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	TSS200 (cg20104535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.41E-05; Z-score: 2.29E-01
Methylation in Case	7.36E-02 (Median)	Methylation in Control	7.03E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	TSS200 (cg19655006)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.50E-05; Z-score: 9.02E-02
Methylation in Case	3.05E-02 (Median)	Methylation in Control	2.88E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	1stExon (cg03770593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 4.76E-06; Z-score: 3.94E-01
Methylation in Case	1.02E-01 (Median)	Methylation in Control	9.19E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg00040027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.41E-06; Z-score: -9.05E-01
Methylation in Case	8.16E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg19931596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.50E-05; Z-score: -1.32E+00
Methylation in Case	8.12E-01 (Median)	Methylation in Control	8.39E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg10446968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 6.10E-04; Z-score: -1.45E-01
Methylation in Case	8.92E-02 (Median)	Methylation in Control	9.15E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	Body (cg23262213)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.64E-02; Z-score: -2.49E-01
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC25A12 in hepatocellular carcinoma			[ 1 ]
Location	3'UTR (cg22166516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.32E-04; Z-score: -6.99E-01
Methylation in Case	8.66E-01 (Median)	Methylation in Control	8.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in pancretic ductal adenocarcinoma			[ 2 ]
Location	TSS1500 (cg03616221)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.29E+00	Statistic Test	p-value: 3.49E-08; Z-score: 1.38E+00
Methylation in Case	3.37E-01 (Median)	Methylation in Control	2.62E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg08832227)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.53E+00	Statistic Test	p-value: 3.77E-20; Z-score: 3.29E+00
Methylation in Case	5.77E-01 (Median)	Methylation in Control	3.78E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A12 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg21216258)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 7.29E-06; Z-score: -7.20E-01
Methylation in Case	7.60E-01 (Median)	Methylation in Control	8.01E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A12 in pancretic ductal adenocarcinoma			[ 2 ]
Location	Body (cg16997104)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 9.77E-03; Z-score: -1.16E+00
Methylation in Case	7.92E-01 (Median)	Methylation in Control	8.63E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in panic disorder			[ 3 ]
Location	TSS1500 (cg27230724)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.74E-01	Statistic Test	p-value: 4.24E-02; Z-score: 4.19E-01
Methylation in Case	-4.13E+00 (Median)	Methylation in Control	-4.24E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in panic disorder			[ 3 ]
Location	Body (cg04337734)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -6.96E-01	Statistic Test	p-value: 4.64E-02; Z-score: -1.29E-01
Methylation in Case	-1.64E-01 (Median)	Methylation in Control	-1.14E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in papillary thyroid cancer			[ 4 ]
Location	TSS1500 (cg03539474)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 3.76E-02; Z-score: -4.37E-01
Methylation in Case	4.71E-02 (Median)	Methylation in Control	5.00E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in papillary thyroid cancer			[ 4 ]
Location	Body (cg04337734)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 6.93E-05; Z-score: -6.70E-01
Methylation in Case	8.71E-01 (Median)	Methylation in Control	8.84E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A12 in papillary thyroid cancer			[ 4 ]
Location	Body (cg23098068)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.85E-03; Z-score: 7.46E-01
Methylation in Case	7.38E-01 (Median)	Methylation in Control	7.05E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in prostate cancer			[ 5 ]
Location	TSS1500 (cg03561565)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.88E+00	Statistic Test	p-value: 3.07E-04; Z-score: 4.98E+00
Methylation in Case	7.65E-01 (Median)	Methylation in Control	4.08E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in systemic lupus erythematosus			[ 6 ]
Location	TSS1500 (cg08856772)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.25E-02; Z-score: -1.51E-01
Methylation in Case	7.36E-02 (Median)	Methylation in Control	7.62E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Breast cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in breast cancer			[ 7 ]
Location	TSS200 (cg20104535)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.60E-02; Z-score: -3.49E-01
Methylation in Case	6.11E-02 (Median)	Methylation in Control	6.51E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in breast cancer			[ 7 ]
Location	Body (cg23098068)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 2.37E-07; Z-score: 1.80E+00
Methylation in Case	5.37E-01 (Median)	Methylation in Control	4.04E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A12 in breast cancer			[ 7 ]
Location	Body (cg04337734)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 2.68E-05; Z-score: 1.12E+00
Methylation in Case	7.91E-01 (Median)	Methylation in Control	6.92E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A12 in breast cancer			[ 7 ]
Location	Body (ch.2.3493243F)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 3.10E-04; Z-score: -8.47E-01
Methylation in Case	8.25E-02 (Median)	Methylation in Control	1.02E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in clear cell renal cell carcinoma			[ 8 ]
Location	TSS200 (cg19655006)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 3.76E-02; Z-score: 1.29E-02
Methylation in Case	1.74E-02 (Median)	Methylation in Control	1.74E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in clear cell renal cell carcinoma			[ 8 ]
Location	Body (cg10446968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 3.31E-02; Z-score: 3.21E-01
Methylation in Case	2.57E-02 (Median)	Methylation in Control	2.41E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in colorectal cancer			[ 9 ]
Location	TSS200 (cg19655006)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.22E+00	Statistic Test	p-value: 1.86E-02; Z-score: -5.23E-01
Methylation in Case	1.46E-02 (Median)	Methylation in Control	1.78E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in colorectal cancer			[ 9 ]
Location	1stExon (cg03770593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 7.33E-04; Z-score: 5.07E-01
Methylation in Case	8.50E-02 (Median)	Methylation in Control	7.86E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A12 in colorectal cancer			[ 9 ]
Location	Body (ch.2.3493243F)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.96E+00	Statistic Test	p-value: 8.37E-07; Z-score: 2.17E+00
Methylation in Case	4.31E-01 (Median)	Methylation in Control	2.20E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	1stExon (cg03770593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.66E+00	Statistic Test	p-value: 1.46E-25; Z-score: -3.66E+00
Methylation in Case	5.01E-01 (Median)	Methylation in Control	8.30E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg00040027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 1.56E-05; Z-score: -7.15E-01
Methylation in Case	1.09E-01 (Median)	Methylation in Control	1.48E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A12 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg04337734)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 7.19E-04; Z-score: 5.68E-01
Methylation in Case	9.15E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A12 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	Body (cg10446968)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 1.48E-02; Z-score: -1.33E-01
Methylation in Case	9.56E-01 (Median)	Methylation in Control	9.59E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A12 in atypical teratoid rhabdoid tumor			[ 10 ]
Location	3'UTR (cg22166516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 6.00E-10; Z-score: -1.43E+00
Methylation in Case	7.50E-01 (Median)	Methylation in Control	8.31E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
HIV infection	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in HIV infection			[ 11 ]
Location	1stExon (cg03770593)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 1.28E-02; Z-score: -5.58E-01
Methylation in Case	6.21E-02 (Median)	Methylation in Control	6.77E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in HIV infection			[ 11 ]
Location	Body (cg23098068)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.65E+00	Statistic Test	p-value: 4.14E-08; Z-score: 3.43E+00
Methylation in Case	5.67E-01 (Median)	Methylation in Control	3.43E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Bladder cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in bladder cancer			[ 12 ]
Location	Body (cg23098068)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 2.01E-05; Z-score: 4.61E+00
Methylation in Case	8.22E-01 (Median)	Methylation in Control	6.44E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A12 in bladder cancer			[ 12 ]
Location	Body (cg23262213)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 7.28E-04; Z-score: -2.63E+00
Methylation in Case	8.30E-01 (Median)	Methylation in Control	8.49E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A12 in bladder cancer			[ 12 ]
Location	Body (cg19931596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 5.19E-03; Z-score: 2.15E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	7.23E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A12 in bladder cancer			[ 12 ]
Location	Body (cg00040027)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.41E-02; Z-score: -1.06E+00
Methylation in Case	8.86E-01 (Median)	Methylation in Control	9.04E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A12 in bladder cancer			[ 12 ]
Location	3'UTR (cg22166516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.51E-02; Z-score: -1.73E+00
Methylation in Case	8.86E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Colon cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in colon adenocarcinoma			[ 13 ]
Location	Body (cg13507893)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 4.84E-03; Z-score: -1.51E+00
Methylation in Case	7.27E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Depression	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in depression			[ 14 ]
Location	Body (cg04337734)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.08E-02; Z-score: -4.96E-01
Methylation in Case	7.70E-01 (Median)	Methylation in Control	7.87E-01 (Median)
Studied Phenotype	Depression [ ICD-11: 6A8Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A12 in lung adenocarcinoma			[ 15 ]
Location	Body (cg19931596)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 4.26E-02; Z-score: 1.71E+00
Methylation in Case	8.27E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Histone acetylation
Hepatocellular carcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Hyperacetylation of SLC25A12 in hepatocellular carcinoma (compare with normal human hepatocytes)			[ 16 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Up regulation of SLC25A12	Experiment Method	Western Blot
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Human hepatocellular carcinoma cell line (HepG2)
Additional Notes	SLC25A12 is epigenetically induced in HCC by mechanisms involving histone acetylation but not DNA methylation.
Epigenetic Phenomenon 2	Hyperacetylation of SLC25A12 in hepatocellular carcinoma (compare with normal human hepatocytes)			[ 16 ]
Location	Promoter
Epigenetic Type	Histone acetylation	Experiment Method	Chromatin immunoprecipitation
Related Molecular Changes	Up regulation of SLC25A12	Experiment Method	Western Blot
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Human hepatocellular carcinoma cell line (HepG2)
Additional Notes	SLC25A12 is epigenetically induced in HCC by mechanisms involving histone acetylation but not DNA methylation.
microRNA
Unclear Phenotype	51 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	let-7b directly targets SLC25A12			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	Proteomics
miRNA Stemloop ID	let-7b	miRNA Mature ID	let-7b-5p
miRNA Sequence	UGAGGUAGUAGGUUGUGUGGUU
miRNA Target Type	Direct
Experimental Material	Human cervical cancer cell line (Hela)
Epigenetic Phenomenon 2	let-7f directly targets SLC25A12			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	let-7f	miRNA Mature ID	let-7f-5p
miRNA Sequence	UGAGGUAGUAGAUUGUAUAGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	miR-100 directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-100	miRNA Mature ID	miR-100-3p
miRNA Sequence	CAAGCUUGUAUCUAUAGGUAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-1267 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1267	miRNA Mature ID	miR-1267
miRNA Sequence	CCUGUUGAAGUGUAAUCCCCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 5	miR-1277 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1277	miRNA Mature ID	miR-1277-5p
miRNA Sequence	AAAUAUAUAUAUAUAUGUACGUAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 6	miR-129-1 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-129-1	miRNA Mature ID	miR-129-1-3p
miRNA Sequence	AAGCCCUUACCCCAAAAAGUAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 7	miR-129-2 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-129-2	miRNA Mature ID	miR-129-2-3p
miRNA Sequence	AAGCCCUUACCCCAAAAAGCAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 8	miR-15a directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-15a	miRNA Mature ID	miR-15a-5p
miRNA Sequence	UAGCAGCACAUAAUGGUUUGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 9	miR-15b directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-15b	miRNA Mature ID	miR-15b-5p
miRNA Sequence	UAGCAGCACAUCAUGGUUUACA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 10	miR-16 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-16	miRNA Mature ID	miR-16-5p
miRNA Sequence	UAGCAGCACGUAAAUAUUGGCG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 11	miR-190a directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-190a	miRNA Mature ID	miR-190a-3p
miRNA Sequence	CUAUAUAUCAAACAUAUUCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 12	miR-195 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-195	miRNA Mature ID	miR-195-5p
miRNA Sequence	UAGCAGCACAGAAAUAUUGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 13	miR-19a directly targets SLC25A12			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-19a	miRNA Mature ID	miR-19a-3p
miRNA Sequence	UGUGCAAAUCUAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-19b directly targets SLC25A12			[ 22 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-19b	miRNA Mature ID	miR-19b-3p
miRNA Sequence	UGUGCAAAUCCAUGCAAAACUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-297 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-297	miRNA Mature ID	miR-297
miRNA Sequence	AUGUAUGUGUGCAUGUGCAUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 16	miR-30c directly targets SLC25A12			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-30c	miRNA Mature ID	miR-30c-5p
miRNA Sequence	UGUAAACAUCCUACACUCUCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 17	miR-3177 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3177	miRNA Mature ID	miR-3177-5p
miRNA Sequence	UGUGUACACACGUGCCAGGCGCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 18	miR-320b directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-320b	miRNA Mature ID	miR-320b
miRNA Sequence	AAAAGCUGGGUUGAGAGGGCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-320c directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-320c	miRNA Mature ID	miR-320c
miRNA Sequence	AAAAGCUGGGUUGAGAGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-320d directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-320d	miRNA Mature ID	miR-320d
miRNA Sequence	AAAAGCUGGGUUGAGAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-3613 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3613	miRNA Mature ID	miR-3613-3p
miRNA Sequence	ACAAAAAAAAAAGCCCAACCCUUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 22	miR-367 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-367	miRNA Mature ID	miR-367-5p
miRNA Sequence	ACUGUUGCUAAUAUGCAACUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 23	miR-3924 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3924	miRNA Mature ID	miR-3924
miRNA Sequence	AUAUGUAUAUGUGACUGCUACU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 24	miR-424 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-424	miRNA Mature ID	miR-424-5p
miRNA Sequence	CAGCAGCAAUUCAUGUUUUGAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 25	miR-4429 directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4429	miRNA Mature ID	miR-4429
miRNA Sequence	AAAAGCUGGGCUGAGAGGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-4432 directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4432	miRNA Mature ID	miR-4432
miRNA Sequence	AAAGACUCUGCAAGAUGCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-4524a directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4524a	miRNA Mature ID	miR-4524a-5p
miRNA Sequence	AUAGCAGCAUGAACCUGUCUCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 28	miR-4524b directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4524b	miRNA Mature ID	miR-4524b-5p
miRNA Sequence	AUAGCAGCAUAAGCCUGUCUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 29	miR-4687 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4687	miRNA Mature ID	miR-4687-5p
miRNA Sequence	CAGCCCUCCUCCCGCACCCAAA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 30	miR-4777 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4777	miRNA Mature ID	miR-4777-3p
miRNA Sequence	AUACCUCAUCUAGAAUGCUGUA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 31	miR-4789 directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4789	miRNA Mature ID	miR-4789-3p
miRNA Sequence	CACACAUAGCAGGUGUAUAUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-493 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-493	miRNA Mature ID	miR-493-5p
miRNA Sequence	UUGUACAUGGUAGGCUUUCAUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 33	miR-494 directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-494	miRNA Mature ID	miR-494-3p
miRNA Sequence	UGAAACAUACACGGGAAACCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-497 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-497	miRNA Mature ID	miR-497-5p
miRNA Sequence	CAGCAGCACACUGUGGUUUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 35	miR-499a directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-499a	miRNA Mature ID	miR-499a-5p
miRNA Sequence	UUAAGACUUGCAGUGAUGUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-5011 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5011	miRNA Mature ID	miR-5011-5p
miRNA Sequence	UAUAUAUACAGCCAUGCACUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 37	miR-503 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-503	miRNA Mature ID	miR-503-5p
miRNA Sequence	UAGCAGCGGGAACAGUUCUGCAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 38	miR-505 directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-505	miRNA Mature ID	miR-505-3p
miRNA Sequence	CGUCAACACUUGCUGGUUUCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 39	miR-510 directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-510	miRNA Mature ID	miR-510-3p
miRNA Sequence	AUUGAAACCUCUAAGAGUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 40	miR-511 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-511	miRNA Mature ID	miR-511-3p
miRNA Sequence	AAUGUGUAGCAAAAGACAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 41	miR-545 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-545	miRNA Mature ID	miR-545-3p
miRNA Sequence	UCAGCAAACAUUUAUUGUGUGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 42	miR-548p directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-548p	miRNA Mature ID	miR-548p
miRNA Sequence	UAGCAAAAACUGCAGUUACUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 43	miR-5580 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5580	miRNA Mature ID	miR-5580-3p
miRNA Sequence	CACAUAUGAAGUGAGCCAGCAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 44	miR-567 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-567	miRNA Mature ID	miR-567
miRNA Sequence	AGUAUGUUCUUCCAGGACAGAAC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 45	miR-646 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-646	miRNA Mature ID	miR-646
miRNA Sequence	AAGCAGCUGCCUCUGAGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 46	miR-6779 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6779	miRNA Mature ID	miR-6779-3p
miRNA Sequence	AAGCCCUGUCUCCUCCCAUCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 47	miR-6838 directly targets SLC25A12			[ 21 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6838	miRNA Mature ID	miR-6838-5p
miRNA Sequence	AAGCAGCAGUGGCAAGACUCCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 48	miR-6867 directly targets SLC25A12			[ 20 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6867	miRNA Mature ID	miR-6867-5p
miRNA Sequence	UGUGUGUGUAGAGGAAGAAGGGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 49	miR-766 directly targets SLC25A12			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-766	miRNA Mature ID	miR-766-3p
miRNA Sequence	ACUCCAGCCCCACAGCCUCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 50	miR-8087 directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8087	miRNA Mature ID	miR-8087
miRNA Sequence	GAAGACUUCUUGGAUUACAGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 51	miR-9 directly targets SLC25A12			[ 19 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-9	miRNA Mature ID	miR-9-3p
miRNA Sequence	AUAAAGCUAGAUAACCGAAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
2	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
3	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
4	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
5	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
6	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
7	Genome-wide Scan for Methylation Profiles in Breast Cancer
8	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
9	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
10	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12	DNA Methylation Dynamics in Urological Tumors.
13	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
14	DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
15	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
16	Epigenetic upregulation and functional role of the mitochondrial aspartate/glutamate carrier isoform 1 in hepatocellular carcinoma. Biochim Biophys Acta Mol Basis Dis. 2019 Jan;1865(1):38-47.
17	Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
18	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
19	The viral and cellular microRNA targetome in lymphoblastoid cell lines. PLoS Pathog. 2012 Jan;8(1):e1002484.
20	A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
21	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
22	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence