Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0171 Transporter Info
Gene Name SLC25A13
Transporter Name Calcium-binding mitochondrial carrier protein Aralar2
Gene ID
10165
UniProt ID
Q9UJS0
Epigenetic Regulations of This DT (EGR)

microRNA

  Unclear Phenotype

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7b directly targets SLC25A13 [ 1 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-10a directly targets SLC25A13 [ 1 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

 UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 3

 miR-142 directly targets SLC25A13 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-142 miRNA Mature ID miR-142-3p

miRNA Sequence

 UGUAGUGUUUCCUACUUUAUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-186 directly targets SLC25A13 [ 1 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-186 miRNA Mature ID miR-186-5p

miRNA Sequence

 CAAAGAAUUCUCCUUUUGGGCU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 5

 miR-4255 directly targets SLC25A13 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4255 miRNA Mature ID miR-4255

miRNA Sequence

 CAGUGUUCAGAGAUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-605 directly targets SLC25A13 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-605 miRNA Mature ID miR-605-5p

miRNA Sequence

 UAAAUCCCAUGGUGCCUUCUCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-96 directly targets SLC25A13 [ 2 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-96 miRNA Mature ID miR-96-3p

miRNA Sequence

 AAUCAUGUGCAGUGCCAAUAUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-98 directly targets SLC25A13 [ 3 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

Methylation

  Pituitary adenoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC25A13 in pituitary adenoma than that in healthy individual

Studied Phenotype

 Pituitary adenoma [ICD-11:2F37]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.33E-07; Fold-change: 0.358514232; Z-score: 3.382771278
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  Uterine carcinosarcoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypermethylation of SLC25A13 in uterine carcinosarcoma than that in healthy individual

Studied Phenotype

 Uterine carcinosarcoma [ICD-11:2B5F]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 0.019921226; Fold-change: 0.34368606; Z-score: 1.194594875
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual

  RELA YAP fusion ependymoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Significant hypomethylation of SLC25A13 in rela yap fusion ependymoma than that in healthy individual

Studied Phenotype

 RELA YAP fusion ependymoma [ICD-11:2A00.0Y]

The Methylation Level of Disease Section Compare with the Healthy Individual

 p-value: 1.52E-22; Fold-change: -0.394892729; Z-score: -2.232614889
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue
Download DT methylation data in the tissue of healthy individual
References
1 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
2 Viral microRNA targetome of KSHV-infected primary effusion lymphoma cell lines. Cell Host Microbe. 2011 Nov 17;10(5):515-26.
3 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.