Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0179 Transporter Info
Gene Name	SLC25A2
Transporter Name	Mitochondrial ornithine transporter 2
Gene ID	83884
UniProt ID	Q9BXI2

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg04349243)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.31E+00	Statistic Test	p-value: 7.69E-10; Z-score: 6.60E+00
Methylation in Case	6.81E-01 (Median)	Methylation in Control	2.95E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	TSS1500 (cg04422990)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.49E+00	Statistic Test	p-value: 2.31E-04; Z-score: 4.04E+00
Methylation in Case	3.67E-01 (Median)	Methylation in Control	2.47E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg04431946)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.16E+00	Statistic Test	p-value: 2.69E-12; Z-score: 4.63E+00
Methylation in Case	7.02E-01 (Median)	Methylation in Control	3.25E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg04442576)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.80E+00	Statistic Test	p-value: 2.26E-09; Z-score: 8.55E+00
Methylation in Case	5.91E-01 (Median)	Methylation in Control	2.11E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg12005098)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.69E+00	Statistic Test	p-value: 1.54E-07; Z-score: 6.14E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	1.47E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg22149516)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.47E+00	Statistic Test	p-value: 7.10E-04; Z-score: 5.76E+00
Methylation in Case	3.44E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	1stExon (cg26708235)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.55E+00	Statistic Test	p-value: 2.23E-08; Z-score: 4.70E+00
Methylation in Case	5.68E-01 (Median)	Methylation in Control	2.23E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	Body (cg21324456)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.78E+00	Statistic Test	p-value: 1.62E-12; Z-score: -4.88E+00
Methylation in Case	1.23E-01 (Median)	Methylation in Control	3.43E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	Body (cg01995743)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.73E+00	Statistic Test	p-value: 5.05E-12; Z-score: 4.23E+00
Methylation in Case	6.06E-01 (Median)	Methylation in Control	2.22E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	Body (cg20912978)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.74E+00	Statistic Test	p-value: 6.08E-10; Z-score: -2.56E+00
Methylation in Case	1.59E-01 (Median)	Methylation in Control	2.76E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC25A2 in colon adenocarcinoma			[ 1 ]
Location	Body (cg03519481)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 7.83E-04; Z-score: -3.27E+00
Methylation in Case	7.46E-01 (Median)	Methylation in Control	8.23E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Bladder cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	TSS1500 (cg26518745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 9.29E-04; Z-score: -3.63E+00
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.92E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	TSS1500 (cg26783353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.64E-02; Z-score: 1.52E+00
Methylation in Case	9.02E-01 (Median)	Methylation in Control	8.76E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	TSS200 (cg25212131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.50E+00	Statistic Test	p-value: 7.30E-11; Z-score: 9.76E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	5.63E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	TSS200 (cg00030420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 1.07E-08; Z-score: 8.94E+00
Methylation in Case	8.45E-01 (Median)	Methylation in Control	6.78E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	TSS200 (cg05845376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.08E+00	Statistic Test	p-value: 2.06E-08; Z-score: 1.05E+01
Methylation in Case	9.08E-01 (Median)	Methylation in Control	4.36E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	TSS200 (cg27320005)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 1.28E-07; Z-score: 7.03E+00
Methylation in Case	8.94E-01 (Median)	Methylation in Control	6.32E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	TSS200 (cg07039560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.74E+00	Statistic Test	p-value: 1.52E-06; Z-score: 6.13E+00
Methylation in Case	7.63E-01 (Median)	Methylation in Control	4.40E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	TSS200 (cg07496545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.76E+00	Statistic Test	p-value: 4.63E-05; Z-score: 5.65E+00
Methylation in Case	9.16E-01 (Median)	Methylation in Control	5.22E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	TSS200 (cg21636683)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.47E+00	Statistic Test	p-value: 7.77E-05; Z-score: 4.18E+00
Methylation in Case	7.41E-01 (Median)	Methylation in Control	5.05E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	1stExon (cg05638493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.22E+00	Statistic Test	p-value: 1.19E-13; Z-score: 1.70E+01
Methylation in Case	6.72E-01 (Median)	Methylation in Control	3.03E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	1stExon (cg03060468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 8.42E-07; Z-score: 2.07E+01
Methylation in Case	6.64E-01 (Median)	Methylation in Control	5.00E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC25A2 in bladder cancer			[ 2 ]
Location	1stExon (cg02553537)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.03E-02; Z-score: -7.49E-01
Methylation in Case	7.73E-01 (Median)	Methylation in Control	7.90E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Renal cell carcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg22748470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.24E-03; Z-score: 1.05E+00
Methylation in Case	8.93E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg26518745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.00E+00	Statistic Test	p-value: 4.52E-03; Z-score: -4.95E-01
Methylation in Case	9.56E-01 (Median)	Methylation in Control	9.59E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg25212131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 4.05E-21; Z-score: 3.84E+00
Methylation in Case	7.79E-01 (Median)	Methylation in Control	5.88E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg05845376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.73E+00	Statistic Test	p-value: 2.79E-18; Z-score: 2.89E+00
Methylation in Case	8.73E-01 (Median)	Methylation in Control	5.03E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg07496545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.73E+00	Statistic Test	p-value: 1.27E-17; Z-score: 2.87E+00
Methylation in Case	8.73E-01 (Median)	Methylation in Control	5.05E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg07039560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.47E+00	Statistic Test	p-value: 1.35E-15; Z-score: 3.37E+00
Methylation in Case	6.40E-01 (Median)	Methylation in Control	4.36E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg27320005)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 3.40E-15; Z-score: 3.25E+00
Methylation in Case	8.49E-01 (Median)	Methylation in Control	6.39E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg00030420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 7.35E-14; Z-score: 3.49E+00
Methylation in Case	9.20E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg21636683)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 1.54E-10; Z-score: 3.09E+00
Methylation in Case	7.91E-01 (Median)	Methylation in Control	6.18E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	1stExon (cg05638493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.54E+00	Statistic Test	p-value: 7.87E-09; Z-score: 3.89E+00
Methylation in Case	5.35E-01 (Median)	Methylation in Control	3.47E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC25A2 in clear cell renal cell carcinoma			[ 3 ]
Location	1stExon (cg03060468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 4.98E-03; Z-score: 1.45E+00
Methylation in Case	6.66E-01 (Median)	Methylation in Control	6.02E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg22748470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.57E-02; Z-score: -5.25E-01
Methylation in Case	8.33E-01 (Median)	Methylation in Control	8.50E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in colorectal cancer			[ 4 ]
Location	1stExon (cg02553537)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.60E-02; Z-score: -2.01E+00
Methylation in Case	9.33E-01 (Median)	Methylation in Control	9.49E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg20361238)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.40E+00	Statistic Test	p-value: 1.23E-15; Z-score: -4.10E+00
Methylation in Case	5.55E-01 (Median)	Methylation in Control	7.76E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg23623667)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.84E+00	Statistic Test	p-value: 2.86E-15; Z-score: 6.88E+00
Methylation in Case	3.66E-01 (Median)	Methylation in Control	1.29E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg26518745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.10E+00	Statistic Test	p-value: 1.32E-07; Z-score: -1.74E+00
Methylation in Case	7.60E-01 (Median)	Methylation in Control	8.33E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg19215261)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.28E-03; Z-score: -5.82E-01
Methylation in Case	8.87E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg22748470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.73E-02; Z-score: 1.40E-01
Methylation in Case	8.23E-01 (Median)	Methylation in Control	8.16E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	TSS200 (cg27320005)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 9.55E-08; Z-score: 1.96E+00
Methylation in Case	8.50E-01 (Median)	Methylation in Control	6.98E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	TSS200 (cg07496545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 1.24E-05; Z-score: 1.72E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	6.73E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	1stExon (cg02553537)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.64E-05; Z-score: -1.57E+00
Methylation in Case	8.33E-01 (Median)	Methylation in Control	8.72E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	1stExon (cg03060468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 2.68E-02; Z-score: 1.38E+00
Methylation in Case	6.10E-01 (Median)	Methylation in Control	5.41E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg12377084)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.50E+00	Statistic Test	p-value: 8.61E-19; Z-score: -8.13E+00
Methylation in Case	5.38E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg13154880)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.06E+00	Statistic Test	p-value: 1.14E-17; Z-score: 8.30E+00
Methylation in Case	3.96E-01 (Median)	Methylation in Control	1.92E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg02675946)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -3.13E+00	Statistic Test	p-value: 4.24E-14; Z-score: -2.09E+00
Methylation in Case	9.90E-02 (Median)	Methylation in Control	3.10E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC25A2 in hepatocellular carcinoma			[ 5 ]
Location	3'UTR (cg15401862)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 1.33E-18; Z-score: -4.49E+00
Methylation in Case	4.47E-01 (Median)	Methylation in Control	7.21E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Panic disorder	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in panic disorder			[ 6 ]
Location	TSS1500 (cg26518745)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.42E+00	Statistic Test	p-value: 4.34E-02; Z-score: 6.73E-01
Methylation in Case	8.83E-01 (Median)	Methylation in Control	6.22E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in panic disorder			[ 6 ]
Location	1stExon (cg03060468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.70E+00	Statistic Test	p-value: 1.19E-02; Z-score: 4.24E-01
Methylation in Case	4.37E-01 (Median)	Methylation in Control	2.57E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in papillary thyroid cancer			[ 7 ]
Location	TSS1500 (cg26783353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.92E-03; Z-score: 7.82E-01
Methylation in Case	9.40E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in papillary thyroid cancer			[ 7 ]
Location	TSS1500 (cg22748470)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 2.49E-03; Z-score: 8.65E-01
Methylation in Case	7.46E-01 (Median)	Methylation in Control	7.00E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in papillary thyroid cancer			[ 7 ]
Location	TSS200 (cg07496545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 6.87E-06; Z-score: 1.22E+00
Methylation in Case	4.38E-01 (Median)	Methylation in Control	3.30E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A2 in papillary thyroid cancer			[ 7 ]
Location	TSS200 (cg05845376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 2.79E-05; Z-score: 9.96E-01
Methylation in Case	4.13E-01 (Median)	Methylation in Control	2.97E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A2 in papillary thyroid cancer			[ 7 ]
Location	TSS200 (cg25212131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 1.19E-04; Z-score: 9.33E-01
Methylation in Case	5.28E-01 (Median)	Methylation in Control	4.77E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A2 in papillary thyroid cancer			[ 7 ]
Location	TSS200 (cg07039560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 8.63E-04; Z-score: 1.06E+00
Methylation in Case	3.85E-01 (Median)	Methylation in Control	3.28E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A2 in papillary thyroid cancer			[ 7 ]
Location	TSS200 (cg00030420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 1.72E-03; Z-score: 9.32E-01
Methylation in Case	7.26E-01 (Median)	Methylation in Control	6.65E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A2 in papillary thyroid cancer			[ 7 ]
Location	TSS200 (cg27320005)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 8.29E-03; Z-score: 6.91E-01
Methylation in Case	5.08E-01 (Median)	Methylation in Control	4.51E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A2 in papillary thyroid cancer			[ 7 ]
Location	1stExon (cg05638493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.70E-03; Z-score: 2.66E-01
Methylation in Case	2.32E-01 (Median)	Methylation in Control	2.18E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in prostate cancer			[ 8 ]
Location	TSS1500 (cg10726357)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 2.31E-03; Z-score: 4.57E+00
Methylation in Case	8.69E-01 (Median)	Methylation in Control	7.02E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in prostate cancer			[ 8 ]
Location	TSS1500 (cg09110274)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 7.48E-03; Z-score: 3.11E+00
Methylation in Case	9.08E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in prostate cancer			[ 8 ]
Location	TSS1500 (cg02505749)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.29E+00	Statistic Test	p-value: 9.45E-03; Z-score: 1.78E+01
Methylation in Case	1.99E-01 (Median)	Methylation in Control	8.67E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A2 in prostate cancer			[ 8 ]
Location	TSS200 (cg07578695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 5.18E+00	Statistic Test	p-value: 1.15E-02; Z-score: 1.98E+01
Methylation in Case	3.63E-01 (Median)	Methylation in Control	7.00E-02 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A2 in prostate cancer			[ 8 ]
Location	Body (cg14565651)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.39E+00	Statistic Test	p-value: 2.05E-03; Z-score: 4.86E+00
Methylation in Case	7.72E-01 (Median)	Methylation in Control	5.57E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A2 in prostate cancer			[ 8 ]
Location	Body (cg18741958)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 2.25E-03; Z-score: 6.07E+00
Methylation in Case	8.49E-01 (Median)	Methylation in Control	6.14E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A2 in prostate cancer			[ 8 ]
Location	Body (cg05418487)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.45E+00	Statistic Test	p-value: 3.01E-03; Z-score: 4.57E+00
Methylation in Case	7.11E-01 (Median)	Methylation in Control	4.90E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A2 in prostate cancer			[ 8 ]
Location	Body (cg08638180)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.84E+00	Statistic Test	p-value: 5.49E-03; Z-score: 9.34E+00
Methylation in Case	7.27E-01 (Median)	Methylation in Control	3.96E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A2 in prostate cancer			[ 8 ]
Location	Body (cg13058819)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.70E+00	Statistic Test	p-value: 1.88E-02; Z-score: -2.32E+00
Methylation in Case	2.41E-01 (Median)	Methylation in Control	4.10E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Moderate hypermethylation of SLC25A2 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.30E-05; Fold-change: 0.235872199; Z-score: 2.459161114
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Breast cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in breast cancer			[ 9 ]
Location	TSS200 (cg21636683)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 1.45E-28; Z-score: 3.70E+00
Methylation in Case	6.89E-01 (Median)	Methylation in Control	5.18E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in breast cancer			[ 9 ]
Location	TSS200 (cg05845376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.68E+00	Statistic Test	p-value: 1.11E-27; Z-score: 3.45E+00
Methylation in Case	8.15E-01 (Median)	Methylation in Control	4.85E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in breast cancer			[ 9 ]
Location	TSS200 (cg07496545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.60E+00	Statistic Test	p-value: 1.29E-22; Z-score: 2.77E+00
Methylation in Case	8.08E-01 (Median)	Methylation in Control	5.04E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A2 in breast cancer			[ 9 ]
Location	TSS200 (cg00030420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 5.93E-18; Z-score: 2.21E+00
Methylation in Case	8.03E-01 (Median)	Methylation in Control	7.10E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A2 in breast cancer			[ 9 ]
Location	TSS200 (cg27320005)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 5.02E-16; Z-score: 2.45E+00
Methylation in Case	7.86E-01 (Median)	Methylation in Control	5.70E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A2 in breast cancer			[ 9 ]
Location	TSS200 (cg25212131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 2.15E-14; Z-score: 1.56E+00
Methylation in Case	6.88E-01 (Median)	Methylation in Control	5.49E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A2 in breast cancer			[ 9 ]
Location	TSS200 (cg07039560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.44E+00	Statistic Test	p-value: 1.71E-13; Z-score: 1.54E+00
Methylation in Case	5.66E-01 (Median)	Methylation in Control	3.92E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A2 in breast cancer			[ 9 ]
Location	1stExon (cg05638493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.62E+00	Statistic Test	p-value: 8.19E-27; Z-score: 3.86E+00
Methylation in Case	5.46E-01 (Median)	Methylation in Control	3.37E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A2 in breast cancer			[ 9 ]
Location	1stExon (cg03060468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.18E+00	Statistic Test	p-value: 1.76E-11; Z-score: 1.66E+00
Methylation in Case	6.02E-01 (Median)	Methylation in Control	5.12E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
HIV infection	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	TSS200 (cg00030420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 4.61E-07; Z-score: 1.28E+00
Methylation in Case	8.54E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	TSS200 (cg07039560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 8.47E-06; Z-score: 1.46E+00
Methylation in Case	7.71E-01 (Median)	Methylation in Control	6.68E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	TSS200 (cg27320005)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 9.15E-06; Z-score: 1.20E+00
Methylation in Case	8.78E-01 (Median)	Methylation in Control	8.02E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	TSS200 (cg25212131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 1.89E-04; Z-score: 1.03E+00
Methylation in Case	8.38E-01 (Median)	Methylation in Control	7.77E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	TSS200 (cg07496545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.95E-04; Z-score: 6.00E-01
Methylation in Case	9.17E-01 (Median)	Methylation in Control	8.74E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	TSS200 (cg21636683)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 4.22E-03; Z-score: 7.69E-01
Methylation in Case	8.45E-01 (Median)	Methylation in Control	8.04E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	TSS200 (cg05845376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 5.29E-03; Z-score: 7.87E-01
Methylation in Case	9.20E-01 (Median)	Methylation in Control	8.56E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	1stExon (cg05638493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 1.62E-05; Z-score: 1.55E+00
Methylation in Case	5.24E-01 (Median)	Methylation in Control	4.37E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	1stExon (cg02553537)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.29E-03; Z-score: -7.32E-01
Methylation in Case	8.73E-01 (Median)	Methylation in Control	9.00E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A2 in HIV infection			[ 10 ]
Location	1stExon (cg03060468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 9.45E-03; Z-score: 1.04E+00
Methylation in Case	6.67E-01 (Median)	Methylation in Control	6.04E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg05845376)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 9.75E-05; Z-score: 2.23E+00
Methylation in Case	8.50E-01 (Median)	Methylation in Control	6.93E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg07496545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.01E-03; Z-score: 1.96E+00
Methylation in Case	8.70E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg27320005)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 3.16E-03; Z-score: 1.58E+00
Methylation in Case	8.44E-01 (Median)	Methylation in Control	7.43E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A2 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg00030420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 3.45E-03; Z-score: 1.77E+00
Methylation in Case	8.58E-01 (Median)	Methylation in Control	7.84E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A2 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg25212131)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 4.86E-03; Z-score: 1.76E+00
Methylation in Case	7.71E-01 (Median)	Methylation in Control	6.75E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A2 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg07039560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 8.86E-03; Z-score: 1.69E+00
Methylation in Case	7.05E-01 (Median)	Methylation in Control	5.87E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A2 in lung adenocarcinoma			[ 11 ]
Location	TSS200 (cg21636683)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 1.44E-02; Z-score: 1.53E+00
Methylation in Case	7.77E-01 (Median)	Methylation in Control	6.92E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A2 in lung adenocarcinoma			[ 11 ]
Location	1stExon (cg05638493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 3.30E-04; Z-score: 2.55E+00
Methylation in Case	5.96E-01 (Median)	Methylation in Control	4.30E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A2 in lung adenocarcinoma			[ 11 ]
Location	1stExon (cg03060468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 1.00E-02; Z-score: 1.70E+00
Methylation in Case	6.71E-01 (Median)	Methylation in Control	5.80E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	TSS200 (cg06956052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 2.97E-02; Z-score: -3.88E-01
Methylation in Case	5.16E-01 (Median)	Methylation in Control	5.29E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg19639560)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.50E-02; Z-score: 3.15E-01
Methylation in Case	6.94E-01 (Median)	Methylation in Control	6.64E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in pancretic ductal adenocarcinoma			[ 12 ]
Location	Body (cg10752421)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 4.83E-02; Z-score: 3.96E-01
Methylation in Case	9.31E-01 (Median)	Methylation in Control	9.20E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in systemic lupus erythematosus			[ 13 ]
Location	TSS200 (cg07496545)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 1.48E-02; Z-score: 2.47E-01
Methylation in Case	8.81E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in systemic lupus erythematosus			[ 13 ]
Location	TSS200 (cg00030420)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 3.05E-02; Z-score: 8.83E-02
Methylation in Case	8.65E-01 (Median)	Methylation in Control	8.58E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A2 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	1stExon (cg02553537)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 4.27E-27; Z-score: -4.87E+00
Methylation in Case	5.76E-01 (Median)	Methylation in Control	8.03E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A2 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	1stExon (cg03060468)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.62E+00	Statistic Test	p-value: 6.72E-26; Z-score: 5.33E+00
Methylation in Case	3.72E-01 (Median)	Methylation in Control	1.42E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A2 in atypical teratoid rhabdoid tumor			[ 14 ]
Location	1stExon (cg05638493)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.41E+00	Statistic Test	p-value: 1.18E-23; Z-score: -5.03E+00
Methylation in Case	5.98E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Anaplastic pleomorphic xanthoastrocytoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in anaplastic pleomorphic xanthoastrocytoma than that in healthy individual
Studied Phenotype	Anaplastic pleomorphic xanthoastrocytoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.99E-05; Fold-change: 0.260927344; Z-score: 1.165572732
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Atypical teratoid rhabdoid tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in atypical teratoid rhabdoid tumour than that in healthy individual
Studied Phenotype	Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.74E-09; Fold-change: 0.254327024; Z-score: 1.279206047
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 5.84E-09; Fold-change: 0.28534596; Z-score: 1.497684076
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroepithelial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in brain neuroepithelial tumour than that in healthy individual
Studied Phenotype	Brain neuroepithelial tumour [ICD-11:2A00.2Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.20E-12; Fold-change: 0.222589169; Z-score: 1.32162559
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Medulloblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in medulloblastoma than that in healthy individual
Studied Phenotype	Medulloblastoma [ICD-11:2A00.10]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 9.56E-25; Fold-change: 0.236984055; Z-score: 1.786196764
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 8.86E-13; Fold-change: 0.274282057; Z-score: 1.56910286
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.84E-05; Fold-change: 0.230117501; Z-score: 1.108801957
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer metastasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in prostate cancer metastasis than that in healthy individual
Studied Phenotype	Prostate cancer metastasis [ICD-11:2.00E+06]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.83E-05; Fold-change: 0.260209701; Z-score: 6.195582292
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
RELA YAP fusion ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in rela yap fusion ependymoma than that in healthy individual
Studied Phenotype	RELA YAP fusion ependymoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.05E-18; Fold-change: 0.235358029; Z-score: 1.599491962
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Third ventricle chordoid glioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A2 in third ventricle chordoid glioma than that in healthy individual
Studied Phenotype	Third ventricle chordoid glioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.005457792; Fold-change: 0.240104097; Z-score: 1.065850813
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Pancreatic cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC25A2 in pancreatic adenocarcinoma than that in healthy individual
Studied Phenotype	Pancreatic cancer [ICD-11:2C10]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.034901044; Fold-change: -0.224297589; Z-score: -3.544077934
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Multilayered rosettes embryonal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC25A2 in multilayered rosettes embryonal tumour than that in healthy individual
Studied Phenotype	Multilayered rosettes embryonal tumour [ICD-11:2A00.1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.34E-11; Fold-change: 0.313091048; Z-score: 1.663505199
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Uterine carcinosarcoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC25A2 in uterine carcinosarcoma than that in healthy individual
Studied Phenotype	Uterine carcinosarcoma [ICD-11:2B5F]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.37E-06; Fold-change: 0.304275576; Z-score: 2.815067823
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Obesity	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC25A2 in obesity than that in healthy individual
Studied Phenotype	Obesity [ICD-11:5B81]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.02E-32; Fold-change: -0.387124081; Z-score: -3.248816818
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-3190 directly targets SLC25A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3190	miRNA Mature ID	miR-3190-5p
miRNA Sequence	UCUGGCCAGCUACGUCCCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-378a directly targets SLC25A2			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-378a	miRNA Mature ID	miR-378a-3p
miRNA Sequence	ACUGGACUUGGAGUCAGAAGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	miR-3926 directly targets SLC25A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3926	miRNA Mature ID	miR-3926
miRNA Sequence	UGGCCAAAAAGCAGGCAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-4786 directly targets SLC25A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4786	miRNA Mature ID	miR-4786-5p
miRNA Sequence	UGAGACCAGGACUGGAUGCACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-548c directly targets SLC25A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548c	miRNA Mature ID	miR-548c-3p
miRNA Sequence	CAAAAAUCUCAAUUACUUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-548s directly targets SLC25A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548s	miRNA Mature ID	miR-548s
miRNA Sequence	AUGGCCAAAACUGCAGUUAUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-6728 directly targets SLC25A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6728	miRNA Mature ID	miR-6728-3p
miRNA Sequence	UCUCUGCUCUGCUCUCCCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-6771 directly targets SLC25A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6771	miRNA Mature ID	miR-6771-3p
miRNA Sequence	CAAACCCCUGUCUACCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-6849 directly targets SLC25A2			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6849	miRNA Mature ID	miR-6849-3p
miRNA Sequence	ACCAGCCUGUGUCCACCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2	DNA Methylation Dynamics in Urological Tumors.
3	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
7	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
8	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9	Genome-wide Scan for Methylation Profiles in Breast Cancer
10	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
11	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
13	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
14	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
15	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
16	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence