Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0180 Transporter Info
Gene Name	SLC25A20
Transporter Name	Carnitine/acylcarnitine translocase
Gene ID	788
UniProt ID	O43772

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in bladder cancer			[ 1 ]
Location	TSS1500 (cg05964212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 1.00E-02; Z-score: -1.99E+00
Methylation in Case	5.24E-01 (Median)	Methylation in Control	6.16E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in bladder cancer			[ 1 ]
Location	TSS200 (cg25624927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.32E+00	Statistic Test	p-value: 2.23E-02; Z-score: -2.90E+00
Methylation in Case	1.86E-02 (Median)	Methylation in Control	4.31E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in bladder cancer			[ 1 ]
Location	Body (cg00948664)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 8.68E-07; Z-score: -4.34E+00
Methylation in Case	4.11E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A20 in bladder cancer			[ 1 ]
Location	Body (cg14014369)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 1.41E-02; Z-score: -1.52E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	8.06E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in breast cancer			[ 2 ]
Location	TSS1500 (cg05964212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 9.86E-09; Z-score: -1.78E+00
Methylation in Case	6.15E-01 (Median)	Methylation in Control	7.43E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in breast cancer			[ 2 ]
Location	TSS1500 (cg04492826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 4.57E-02; Z-score: -3.36E-01
Methylation in Case	9.11E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in breast cancer			[ 2 ]
Location	TSS200 (cg22919115)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 1.55E-02; Z-score: 6.30E-01
Methylation in Case	3.85E-01 (Median)	Methylation in Control	3.49E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A20 in breast cancer			[ 2 ]
Location	Body (cg00948664)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.24E+00	Statistic Test	p-value: 5.36E-09; Z-score: -1.26E+00
Methylation in Case	4.71E-01 (Median)	Methylation in Control	5.82E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A20 in breast cancer			[ 2 ]
Location	Body (cg01191114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 4.29E-02; Z-score: 2.93E-01
Methylation in Case	1.08E-02 (Median)	Methylation in Control	9.54E-03 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg05964212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 1.56E-09; Z-score: -2.70E+00
Methylation in Case	7.68E-01 (Median)	Methylation in Control	9.08E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg04492826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 5.05E-06; Z-score: -1.56E+00
Methylation in Case	9.73E-01 (Median)	Methylation in Control	9.79E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg15588941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 8.83E-06; Z-score: -2.42E+00
Methylation in Case	7.54E-01 (Median)	Methylation in Control	8.21E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A20 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg18630857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.25E-02; Z-score: 5.86E-01
Methylation in Case	3.47E-02 (Median)	Methylation in Control	3.21E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A20 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg20495332)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.58E+00	Statistic Test	p-value: 4.58E-11; Z-score: -2.32E+00
Methylation in Case	3.52E-02 (Median)	Methylation in Control	9.07E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A20 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg00948664)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.43E+00	Statistic Test	p-value: 5.89E-07; Z-score: -2.69E+00
Methylation in Case	4.30E-01 (Median)	Methylation in Control	6.15E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A20 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg01191114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 5.95E-06; Z-score: 1.01E+00
Methylation in Case	1.88E-02 (Median)	Methylation in Control	1.66E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colon cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in colon adenocarcinoma			[ 4 ]
Location	TSS1500 (cg18710929)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 4.24E+00	Statistic Test	p-value: 4.12E-06; Z-score: 1.48E+01
Methylation in Case	3.85E-01 (Median)	Methylation in Control	9.08E-02 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in colon adenocarcinoma			[ 4 ]
Location	TSS200 (cg27037018)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.88E+00	Statistic Test	p-value: 7.90E-08; Z-score: 5.78E+00
Methylation in Case	5.95E-01 (Median)	Methylation in Control	1.53E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in colon adenocarcinoma			[ 4 ]
Location	TSS200 (cg17037355)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 9.49E-07; Z-score: 3.93E+00
Methylation in Case	6.14E-01 (Median)	Methylation in Control	4.84E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A20 in colon adenocarcinoma			[ 4 ]
Location	TSS200 (cg26836233)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 4.43E-06; Z-score: 2.44E+00
Methylation in Case	5.32E-01 (Median)	Methylation in Control	4.08E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A20 in colon adenocarcinoma			[ 4 ]
Location	TSS200 (cg21017569)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 6.67E-06; Z-score: 1.08E+00
Methylation in Case	8.88E-01 (Median)	Methylation in Control	8.37E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A20 in colon adenocarcinoma			[ 4 ]
Location	TSS200 (cg26494252)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 3.32E-03; Z-score: -8.01E-01
Methylation in Case	6.17E-01 (Median)	Methylation in Control	6.31E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A20 in colon adenocarcinoma			[ 4 ]
Location	Body (cg09283154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.76E+00	Statistic Test	p-value: 1.44E-08; Z-score: 4.86E+00
Methylation in Case	4.81E-01 (Median)	Methylation in Control	2.73E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg05964212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 5.10E-08; Z-score: 1.57E+00
Methylation in Case	6.82E-01 (Median)	Methylation in Control	5.53E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in hepatocellular carcinoma			[ 5 ]
Location	TSS200 (cg15588941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 3.09E-06; Z-score: 1.23E+00
Methylation in Case	6.84E-01 (Median)	Methylation in Control	6.09E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg00948664)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 1.51E-03; Z-score: -8.36E-01
Methylation in Case	2.05E-01 (Median)	Methylation in Control	2.59E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in lung adenocarcinoma			[ 6 ]
Location	TSS1500 (cg05964212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 2.69E-04; Z-score: -3.79E+00
Methylation in Case	5.42E-01 (Median)	Methylation in Control	6.67E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg20963030)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 4.49E-03; Z-score: 9.23E-01
Methylation in Case	7.83E-01 (Median)	Methylation in Control	7.43E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg20822540)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 1.99E-02; Z-score: -7.43E-01
Methylation in Case	7.13E-01 (Median)	Methylation in Control	7.97E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg10782875)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 2.23E-02; Z-score: -5.18E-01
Methylation in Case	9.73E-02 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A20 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg03993154)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.18E+00	Statistic Test	p-value: 3.38E-02; Z-score: -4.56E-01
Methylation in Case	1.20E-01 (Median)	Methylation in Control	1.41E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in panic disorder			[ 8 ]
Location	TSS1500 (cg05964212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.38E-01	Statistic Test	p-value: 4.40E-03; Z-score: 5.32E-01
Methylation in Case	-2.61E+00 (Median)	Methylation in Control	-2.78E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in panic disorder			[ 8 ]
Location	TSS200 (cg15588941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 1.87E-02; Z-score: 4.25E-01
Methylation in Case	1.13E+00 (Median)	Methylation in Control	9.62E-01 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in panic disorder			[ 8 ]
Location	TSS200 (cg18630857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.89E-01	Statistic Test	p-value: 3.25E-02; Z-score: 3.43E-01
Methylation in Case	-5.01E+00 (Median)	Methylation in Control	-5.07E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg05964212)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.16E-02; Z-score: -4.50E-01
Methylation in Case	8.44E-01 (Median)	Methylation in Control	8.77E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in papillary thyroid cancer			[ 9 ]
Location	TSS200 (cg25624927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.00E-04; Z-score: -1.06E+00
Methylation in Case	8.63E-02 (Median)	Methylation in Control	1.09E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in papillary thyroid cancer			[ 9 ]
Location	TSS200 (cg18630857)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 5.04E-03; Z-score: -5.66E-01
Methylation in Case	9.29E-02 (Median)	Methylation in Control	1.01E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A20 in papillary thyroid cancer			[ 9 ]
Location	Body (cg20495332)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.39E+00	Statistic Test	p-value: 1.65E-03; Z-score: -1.30E+00
Methylation in Case	1.13E-01 (Median)	Methylation in Control	1.57E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Colorectal cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in colorectal cancer			[ 10 ]
Location	TSS200 (cg22919115)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 2.95E-05; Z-score: -1.12E+00
Methylation in Case	4.86E-01 (Median)	Methylation in Control	5.39E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in colorectal cancer			[ 10 ]
Location	TSS200 (cg15588941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 3.53E-03; Z-score: -5.55E-01
Methylation in Case	7.15E-01 (Median)	Methylation in Control	7.35E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in colorectal cancer			[ 10 ]
Location	Body (cg14014369)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 6.43E-05; Z-score: -1.09E+00
Methylation in Case	8.71E-01 (Median)	Methylation in Control	8.91E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A20 in colorectal cancer			[ 10 ]
Location	Body (cg00948664)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 1.25E-02; Z-score: -5.05E-01
Methylation in Case	4.33E-01 (Median)	Methylation in Control	4.92E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A20 in colorectal cancer			[ 10 ]
Location	Body (cg20495332)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 2.69E-02; Z-score: 4.68E-01
Methylation in Case	1.21E-01 (Median)	Methylation in Control	1.13E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
HIV infection	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in HIV infection			[ 11 ]
Location	TSS200 (cg22919115)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 3.29E-04; Z-score: -1.20E+00
Methylation in Case	4.11E-01 (Median)	Methylation in Control	4.73E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in HIV infection			[ 11 ]
Location	TSS200 (cg15588941)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.09E+00	Statistic Test	p-value: 4.74E-04; Z-score: -1.10E+00
Methylation in Case	6.12E-01 (Median)	Methylation in Control	6.69E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in HIV infection			[ 11 ]
Location	Body (cg20495332)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 2.40E-03; Z-score: -8.67E-01
Methylation in Case	6.42E-02 (Median)	Methylation in Control	7.66E-02 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A20 in HIV infection			[ 11 ]
Location	Body (cg00948664)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 4.75E-02; Z-score: 4.96E-01
Methylation in Case	3.11E-01 (Median)	Methylation in Control	2.83E-01 (Median)
Studied Phenotype	HIV infection [ ICD-11: 1C62.Z]
Experimental Material	Patient tissue samples
Systemic lupus erythematosus	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in systemic lupus erythematosus			[ 12 ]
Location	TSS200 (cg25624927)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 2.09E-02; Z-score: -2.53E-01
Methylation in Case	2.09E-02 (Median)	Methylation in Control	2.34E-02 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in systemic lupus erythematosus			[ 12 ]
Location	Body (cg14014369)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.91E-02; Z-score: -1.18E-01
Methylation in Case	7.59E-01 (Median)	Methylation in Control	7.63E-01 (Median)
Studied Phenotype	Systemic lupus erythematosus [ ICD-11: 4A40.0]
Experimental Material	Patient tissue samples
Atypical teratoid rhabdoid tumor	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	Body (cg00948664)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.61E+00	Statistic Test	p-value: 4.38E-05; Z-score: 1.10E+00
Methylation in Case	5.23E-01 (Median)	Methylation in Control	3.25E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	Body (cg01191114)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 5.24E-05; Z-score: 7.67E-01
Methylation in Case	1.13E-01 (Median)	Methylation in Control	9.66E-02 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A20 in atypical teratoid rhabdoid tumor			[ 13 ]
Location	Body (cg14014369)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 4.20E-02; Z-score: 2.98E-01
Methylation in Case	8.92E-01 (Median)	Methylation in Control	8.64E-01 (Median)
Studied Phenotype	Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]
Experimental Material	Patient tissue samples
Celiac disease	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in celiac disease			[ 14 ]
Location	Body (cg00948664)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.49E+00	Statistic Test	p-value: 3.46E-02; Z-score: 9.10E-01
Methylation in Case	1.51E-01 (Median)	Methylation in Control	1.02E-01 (Median)
Studied Phenotype	Celiac disease [ ICD-11: DA95]
Experimental Material	Patient tissue samples
Prostate cancer	3 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A20 in prostate cancer			[ 15 ]
Location	Body (cg16680214)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.60E+00	Statistic Test	p-value: 3.74E-02; Z-score: -1.78E+00
Methylation in Case	1.41E-01 (Median)	Methylation in Control	2.25E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A20 in prostate cancer			[ 15 ]
Location	Body (cg11624345)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 4.01E-02; Z-score: 1.90E+00
Methylation in Case	7.55E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Oligodendroglial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC25A20 in oligodendroglial tumour than that in healthy individual
Studied Phenotype	Oligodendroglial tumour [ICD-11:2A00.Y1]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.32E-08; Fold-change: 0.202539012; Z-score: 34.6775561
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Oligodendroglioma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC25A20 in oligodendroglioma than that in healthy individual
Studied Phenotype	Oligodendroglioma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 6.89E-53; Fold-change: 0.383417074; Z-score: 12.33871769
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
microRNA
Unclear Phenotype	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-3156 directly targets SLC25A20			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3156	miRNA Mature ID	miR-3156-5p
miRNA Sequence	AAAGAUCUGGAAGUGGGAGACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-3658 directly targets SLC25A20			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3658	miRNA Mature ID	miR-3658
miRNA Sequence	UUUAAGAAAACACCAUGGAGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-500a directly targets SLC25A20			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-500a	miRNA Mature ID	miR-500a-5p
miRNA Sequence	UAAUCCUUGCUACCUGGGUGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-501 directly targets SLC25A20			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-501	miRNA Mature ID	miR-501-5p
miRNA Sequence	AAUCCUUUGUCCCUGGGUGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-7856 directly targets SLC25A20			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7856	miRNA Mature ID	miR-7856-5p
miRNA Sequence	UUUUAAGGACACUGAGGGAUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
11	HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12	Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
13	Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
14	The methylome of the celiac intestinal epithelium harbours genotype-independent alterations in the HLA region. Mol Ther Oncolytics. 2019 Feb 5;12:235-245.
15	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
16	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence