Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0185 Transporter Info
Gene Name SLC25A24
Transporter Name Calcium-binding mitochondrial carrier protein SCaMC-1
Gene ID
29957
UniProt ID
Q6NUK1
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in bladder cancer [ 1 ]

Location

 TSS1500 (cg17297328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -3.83E+00 Statistic Test p-value: 1.08E-04; Z-score: -3.86E+00

Methylation in Case

 6.85E-02 (Median) Methylation in Control 2.63E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in bladder cancer [ 1 ]

Location

 TSS1500 (cg00999623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 1.79E-03; Z-score: -2.05E+00

Methylation in Case

 1.58E-01 (Median) Methylation in Control 1.89E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A24 in bladder cancer [ 1 ]

Location

 TSS1500 (cg23962285)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.34E+00 Statistic Test p-value: 1.15E-02; Z-score: -1.56E+00

Methylation in Case

 3.38E-02 (Median) Methylation in Control 4.52E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A24 in bladder cancer [ 1 ]

Location

 TSS1500 (cg23050784)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.54E+00 Statistic Test p-value: 3.60E-02; Z-score: -1.54E+00

Methylation in Case

 4.03E-02 (Median) Methylation in Control 6.20E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in breast cancer [ 2 ]

Location

 TSS1500 (cg00999623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 9.11E-04; Z-score: -4.96E-01

Methylation in Case

 1.14E-01 (Median) Methylation in Control 1.34E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in breast cancer [ 2 ]

Location

 TSS1500 (cg09214920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 2.22E-02; Z-score: -3.44E-01

Methylation in Case

 5.52E-02 (Median) Methylation in Control 6.66E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A24 in breast cancer [ 2 ]

Location

 TSS1500 (cg23962285)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 2.30E-02; Z-score: -5.25E-01

Methylation in Case

 3.26E-02 (Median) Methylation in Control 3.83E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A24 in breast cancer [ 2 ]

Location

 TSS200 (cg04220635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.16E-02; Z-score: -3.36E-01

Methylation in Case

 6.79E-02 (Median) Methylation in Control 7.21E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A24 in breast cancer [ 2 ]

Location

 Body (cg24323958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.73E+00 Statistic Test p-value: 1.14E-07; Z-score: 1.80E+00

Methylation in Case

 1.94E-01 (Median) Methylation in Control 1.12E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A24 in breast cancer [ 2 ]

Location

 Body (cg00971228)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.51E-04; Z-score: -7.60E-01

Methylation in Case

 8.82E-01 (Median) Methylation in Control 8.94E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg17297328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.60E+00 Statistic Test p-value: 1.68E-14; Z-score: -3.52E+00

Methylation in Case

 8.57E-02 (Median) Methylation in Control 2.23E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg23050784)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 5.40E-03; Z-score: -7.07E-01

Methylation in Case

 2.31E-02 (Median) Methylation in Control 2.79E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS1500 (cg00999623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 2.49E-02; Z-score: 4.14E-01

Methylation in Case

 6.76E-02 (Median) Methylation in Control 6.23E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

 TSS200 (cg04220635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 8.99E-03; Z-score: 5.41E-01

Methylation in Case

 2.69E-02 (Median) Methylation in Control 2.35E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A24 in clear cell renal cell carcinoma [ 3 ]

Location

 Body (cg14662970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 5.94E-03; Z-score: 4.77E-01

Methylation in Case

 1.87E-02 (Median) Methylation in Control 1.77E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

 TSS1500 (cg07337598)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 1.35E-03; Z-score: -1.59E+00

Methylation in Case

 4.93E-01 (Median) Methylation in Control 5.89E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

 TSS200 (cg24084363)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.32E+00 Statistic Test p-value: 9.42E-04; Z-score: 1.52E+00

Methylation in Case

 8.76E-02 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

 Body (cg10791541)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.60E+00 Statistic Test p-value: 1.98E-09; Z-score: -2.03E+00

Methylation in Case

 3.08E-01 (Median) Methylation in Control 4.94E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

 Body (cg14285937)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 8.45E-04; Z-score: -2.04E+00

Methylation in Case

 9.53E-01 (Median) Methylation in Control 9.63E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A24 in colon adenocarcinoma [ 4 ]

Location

 Body (cg14655994)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.54E-03; Z-score: -1.60E+00

Methylation in Case

 6.03E-01 (Median) Methylation in Control 6.57E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg00999623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 6.45E-03; Z-score: -3.25E-01

Methylation in Case

 1.46E-01 (Median) Methylation in Control 1.57E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg09214920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 4.73E-02; Z-score: -3.33E-01

Methylation in Case

 1.05E-01 (Median) Methylation in Control 1.18E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg09214920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.81E-04; Z-score: 3.12E-01

Methylation in Case

 8.29E-02 (Median) Methylation in Control 7.70E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg23962285)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 4.15E-04; Z-score: 7.62E-01

Methylation in Case

 1.38E-01 (Median) Methylation in Control 9.97E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg21421408)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 3.04E-03; Z-score: 3.93E-01

Methylation in Case

 5.48E-02 (Median) Methylation in Control 5.04E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg16600889)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 3.85E-06; Z-score: 3.33E-01

Methylation in Case

 4.40E-02 (Median) Methylation in Control 3.93E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg04220635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.32E+00 Statistic Test p-value: 8.41E-06; Z-score: 1.21E+00

Methylation in Case

 1.04E-01 (Median) Methylation in Control 7.87E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg07185425)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.56E+00 Statistic Test p-value: 2.68E-18; Z-score: -8.38E+00

Methylation in Case

 5.07E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg08294044)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.69E+00 Statistic Test p-value: 8.86E-17; Z-score: -1.33E+01

Methylation in Case

 5.38E-01 (Median) Methylation in Control 9.11E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg08149333)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 5.06E-05; Z-score: 4.15E-01

Methylation in Case

 7.49E-02 (Median) Methylation in Control 6.24E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg14662970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 1.40E-04; Z-score: 4.49E-01

Methylation in Case

 3.55E-02 (Median) Methylation in Control 2.76E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC25A24 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg24323958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 3.58E-04; Z-score: -1.41E+00

Methylation in Case

 3.05E-01 (Median) Methylation in Control 3.97E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in HIV infection [ 7 ]

Location

 TSS1500 (cg17297328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.62E+00 Statistic Test p-value: 1.01E-06; Z-score: 1.88E+00

Methylation in Case

 1.22E-01 (Median) Methylation in Control 7.57E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in HIV infection [ 7 ]

Location

 Body (cg24323958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.54E+00 Statistic Test p-value: 6.83E-06; Z-score: 2.46E+00

Methylation in Case

 4.94E-01 (Median) Methylation in Control 3.21E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in lung adenocarcinoma [ 8 ]

Location

 TSS1500 (cg17297328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.67E+00 Statistic Test p-value: 4.00E-03; Z-score: -2.19E+00

Methylation in Case

 2.05E-01 (Median) Methylation in Control 3.43E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in lung adenocarcinoma [ 8 ]

Location

 Body (cg24323958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.66E+00 Statistic Test p-value: 6.43E-03; Z-score: 3.29E+00

Methylation in Case

 3.26E-01 (Median) Methylation in Control 1.97E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg03434847)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 5.14E-05; Z-score: 1.41E-01

Methylation in Case

 6.86E-02 (Median) Methylation in Control 6.62E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS1500 (cg06631310)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 8.05E-03; Z-score: -1.78E-01

Methylation in Case

 4.55E-01 (Median) Methylation in Control 4.63E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg07011163)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.89E+00 Statistic Test p-value: 5.35E-06; Z-score: -1.15E+00

Methylation in Case

 1.63E-01 (Median) Methylation in Control 3.07E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

 TSS200 (cg10336600)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 7.59E-03; Z-score: -3.23E-01

Methylation in Case

 9.01E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg00304388)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 3.57E+00 Statistic Test p-value: 4.74E-26; Z-score: 4.10E+00

Methylation in Case

 2.49E-01 (Median) Methylation in Control 6.98E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A24 in pancretic ductal adenocarcinoma [ 9 ]

Location

 Body (cg26758427)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.60E-03; Z-score: -2.92E-01

Methylation in Case

 8.68E-01 (Median) Methylation in Control 8.73E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg17297328)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.41E+00 Statistic Test p-value: 7.40E-11; Z-score: -1.45E+00

Methylation in Case

 1.47E-01 (Median) Methylation in Control 2.06E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg23962285)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 2.43E-07; Z-score: -1.06E+00

Methylation in Case

 5.78E-02 (Median) Methylation in Control 6.86E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg09214920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 5.00E-04; Z-score: -5.63E-01

Methylation in Case

 5.95E-02 (Median) Methylation in Control 6.47E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

 TSS1500 (cg00999623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 8.56E-03; Z-score: -2.88E-01

Methylation in Case

 9.62E-02 (Median) Methylation in Control 1.01E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A24 in papillary thyroid cancer [ 10 ]

Location

 Body (cg24323958)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.65E+00 Statistic Test p-value: 1.47E-06; Z-score: -1.43E+00

Methylation in Case

 1.86E-01 (Median) Methylation in Control 3.08E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in systemic lupus erythematosus [ 11 ]

Location

 TSS1500 (cg21421408)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.65E-02; Z-score: -1.71E-01

Methylation in Case

 5.54E-02 (Median) Methylation in Control 5.77E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in systemic lupus erythematosus [ 11 ]

Location

 TSS1500 (cg00999623)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.39E-02; Z-score: -7.69E-02

Methylation in Case

 1.25E-01 (Median) Methylation in Control 1.27E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A24 in systemic lupus erythematosus [ 11 ]

Location

 Body (cg08149333)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.14E-03; Z-score: -2.28E-01

Methylation in Case

 6.09E-02 (Median) Methylation in Control 6.42E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in depression [ 12 ]

Location

 TSS200 (cg04220635)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.26E-02; Z-score: 4.76E-01

Methylation in Case

 6.42E-02 (Median) Methylation in Control 6.17E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A24 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 Body (cg00971228)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 4.47E-05; Z-score: 7.58E-01

Methylation in Case

 8.87E-01 (Median) Methylation in Control 8.17E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A24 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 Body (cg08149333)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 5.41E-03; Z-score: 6.57E-01

Methylation in Case

 8.68E-01 (Median) Methylation in Control 7.69E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A24 in atypical teratoid rhabdoid tumor [ 13 ]

Location

 Body (cg14662970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.49E+00 Statistic Test p-value: 4.91E-02; Z-score: -5.03E-01

Methylation in Case

 2.36E-02 (Median) Methylation in Control 3.51E-02 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7b directly targets SLC25A24 [ 14 ]

Epigenetic Type

 microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-1305 directly targets SLC25A24 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1305 miRNA Mature ID miR-1305

miRNA Sequence

 UUUUCAACUCUAAUGGGAGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-335 directly targets SLC25A24 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-3p

miRNA Sequence

 UUUUUCAUUAUUGCUCCUGACC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-374a directly targets SLC25A24 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-374a miRNA Mature ID miR-374a-5p

miRNA Sequence

 UUAUAAUACAACCUGAUAAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-374b directly targets SLC25A24 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-374b miRNA Mature ID miR-374b-5p

miRNA Sequence

 AUAUAAUACAACCUGCUAAGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-4275 directly targets SLC25A24 [ 15 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4275 miRNA Mature ID miR-4275

miRNA Sequence

 CCAAUUACCACUUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Genome-wide Scan for Methylation Profiles in Breast Cancer
3 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
10 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
11 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
12 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
13 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
14 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
15 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.