Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0186 Transporter Info | ||||
Gene Name | SLC25A25 | ||||
Transporter Name | Calcium-binding mitochondrial carrier protein SCaMC-2 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Atypical teratoid rhabdoid tumor |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC25A25 in atypical teratoid rhabdoid tumor | [ 1 ] | |||
Location |
Body (cg14039237) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 4.23E-02; Z-score: -6.75E-03 | ||
Methylation in Case |
1.35E-01 (Median) | Methylation in Control | 1.35E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC25A25 in bladder cancer | [ 2 ] | |||
Location |
Body (cg14039237) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 2.61E+00 | Statistic Test | p-value: 1.54E-08; Z-score: 7.00E+00 | ||
Methylation in Case |
5.21E-01 (Median) | Methylation in Control | 1.99E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC25A25 in breast cancer | [ 3 ] | |||
Location |
Body (cg14039237) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.58E+00 | Statistic Test | p-value: 7.25E-09; Z-score: -1.96E+00 | ||
Methylation in Case |
1.77E-01 (Median) | Methylation in Control | 2.79E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC25A25 in colorectal cancer | [ 4 ] | |||
Location |
Body (cg14039237) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 9.72E-03; Z-score: -6.63E-01 | ||
Methylation in Case |
5.16E-01 (Median) | Methylation in Control | 5.84E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Hepatocellular carcinoma |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC25A25 in hepatocellular carcinoma | [ 5 ] | |||
Location |
Body (cg23244463) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.87E+00 | Statistic Test | p-value: 7.23E-20; Z-score: -6.60E+00 | ||
Methylation in Case |
4.13E-01 (Median) | Methylation in Control | 7.74E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 2 |
Methylation of SLC25A25 in hepatocellular carcinoma | [ 5 ] | |||
Location |
Body (cg14039237) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.40E+00 | Statistic Test | p-value: 2.27E-03; Z-score: -1.39E+00 | ||
Methylation in Case |
1.80E-01 (Median) | Methylation in Control | 2.52E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
HIV infection |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC25A25 in HIV infection | [ 6 ] | |||
Location |
Body (cg14039237) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.65E+00 | Statistic Test | p-value: 2.32E-08; Z-score: 3.25E+00 | ||
Methylation in Case |
2.45E-01 (Median) | Methylation in Control | 1.48E-01 (Median) | ||
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC25A25 in lung adenocarcinoma | [ 7 ] | |||
Location |
Body (cg14039237) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.30E+00 | Statistic Test | p-value: 2.51E-03; Z-score: -2.03E+00 | ||
Methylation in Case |
3.66E-01 (Median) | Methylation in Control | 4.74E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC25A25 in prostate cancer | [ 8 ] | |||
Location |
Body (cg20050113) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.50E+00 | Statistic Test | p-value: 3.85E-02; Z-score: -5.37E+00 | ||
Methylation in Case |
2.65E-01 (Median) | Methylation in Control | 3.97E-01 (Median) | ||
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Craniopharyngioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC25A25 in craniopharyngioma than that in healthy individual | ||||
Studied Phenotype |
Craniopharyngioma [ICD-11:2F9A] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000636017; Fold-change: 0.240133631; Z-score: 1.112959154 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Hemangioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC25A25 in hemangioblastoma than that in healthy individual | ||||
Studied Phenotype |
Hemangioblastoma [ICD-11:2F7C] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.046008131; Fold-change: 0.204745563; Z-score: 0.919189537 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC25A25 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 9.85E-15; Fold-change: 0.298593537; Z-score: 1.60342923 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Diffuse midline glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC25A25 in diffuse midline glioma than that in healthy individual | ||||
Studied Phenotype |
Diffuse midline glioma [ICD-11:2A00.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.29E-16; Fold-change: -0.242426077; Z-score: -1.248312192 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Esthesioneuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC25A25 in esthesioneuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Esthesioneuroblastoma [ICD-11:2D50.1] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 6.24E-10; Fold-change: -0.280126047; Z-score: -1.227627506 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Glioblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC25A25 in glioblastoma than that in healthy individual | ||||
Studied Phenotype |
Glioblastoma [ICD-11:2A00.00] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.48E-08; Fold-change: -0.231820603; Z-score: -1.07620511 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Low grade glioma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC25A25 in low grade glioma than that in healthy individual | ||||
Studied Phenotype |
Low grade glioma [ICD-11:2A00.0Z] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 5.38E-24; Fold-change: -0.219668313; Z-score: -1.139902203 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Malignant astrocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC25A25 in malignant astrocytoma than that in healthy individual | ||||
Studied Phenotype |
Malignant astrocytoma [ICD-11:2A00.12] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 5.72E-31; Fold-change: -0.299042398; Z-score: -1.552532589 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC25A25 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 6.96E-10; Fold-change: -0.714044903; Z-score: -35.06883413 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
microRNA |
|||||
Unclear Phenotype |
34 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1236 directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1236 | miRNA Mature ID | miR-1236-3p | ||
miRNA Sequence |
CCUCUUCCCCUUGUCUCUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-1271 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1271 | miRNA Mature ID | miR-1271-5p | ||
miRNA Sequence |
CUUGGCACCUAGCAAGCACUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-143 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-143 | miRNA Mature ID | miR-143-3p | ||
miRNA Sequence |
UGAGAUGAAGCACUGUAGCUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-181a directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-181a | miRNA Mature ID | miR-181a-5p | ||
miRNA Sequence |
AACAUUCAACGCUGUCGGUGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-181b directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-181b | miRNA Mature ID | miR-181b-5p | ||
miRNA Sequence |
AACAUUCAUUGCUGUCGGUGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-181c directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-181c | miRNA Mature ID | miR-181c-5p | ||
miRNA Sequence |
AACAUUCAACCUGUCGGUGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-181d directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-181d | miRNA Mature ID | miR-181d-5p | ||
miRNA Sequence |
AACAUUCAUUGUUGUCGGUGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-183 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-183 | miRNA Mature ID | miR-183-5p | ||
miRNA Sequence |
UAUGGCACUGGUAGAAUUCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-1972 directly targets SLC25A25 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1972 | miRNA Mature ID | miR-1972 | ||
miRNA Sequence |
UCAGGCCAGGCACAGUGGCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-205 directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-205 | miRNA Mature ID | miR-205-5p | ||
miRNA Sequence |
UCCUUCAUUCCACCGGAGUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-27a directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-27a | miRNA Mature ID | miR-27a-3p | ||
miRNA Sequence |
UUCACAGUGGCUAAGUUCCGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-27b directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-27b | miRNA Mature ID | miR-27b-3p | ||
miRNA Sequence |
UUCACAGUGGCUAAGUUCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-3124 directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3124 | miRNA Mature ID | miR-3124-3p | ||
miRNA Sequence |
ACUUUCCUCACUCCCGUGAAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-3660 directly targets SLC25A25 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3660 | miRNA Mature ID | miR-3660 | ||
miRNA Sequence |
ACUGACAGGAGAGCAUUUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-378a directly targets SLC25A25 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-378a | miRNA Mature ID | miR-378a-5p | ||
miRNA Sequence |
CUCCUGACUCCAGGUCCUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-4262 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4262 | miRNA Mature ID | miR-4262 | ||
miRNA Sequence |
GACAUUCAGACUACCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-4267 directly targets SLC25A25 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4267 | miRNA Mature ID | miR-4267 | ||
miRNA Sequence |
UCCAGCUCGGUGGCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-4457 directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4457 | miRNA Mature ID | miR-4457 | ||
miRNA Sequence |
UCACAAGGUAUUGACUGGCGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 19 |
miR-4526 directly targets SLC25A25 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4526 | miRNA Mature ID | miR-4526 | ||
miRNA Sequence |
GCUGACAGCAGGGCUGGCCGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 20 |
miR-4770 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4770 | miRNA Mature ID | miR-4770 | ||
miRNA Sequence |
UGAGAUGACACUGUAGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 21 |
miR-4793 directly targets SLC25A25 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4793 | miRNA Mature ID | miR-4793-5p | ||
miRNA Sequence |
ACAUCCUGCUCCACAGGGCAGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-501 directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-501 | miRNA Mature ID | miR-501-5p | ||
miRNA Sequence |
AAUCCUUUGUCCCUGGGUGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 23 |
miR-513a directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-513a | miRNA Mature ID | miR-513a-5p | ||
miRNA Sequence |
UUCACAGGGAGGUGUCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 24 |
miR-604 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-604 | miRNA Mature ID | miR-604 | ||
miRNA Sequence |
AGGCUGCGGAAUUCAGGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-6088 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6088 | miRNA Mature ID | miR-6088 | ||
miRNA Sequence |
AGAGAUGAAGCGGGGGGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 26 |
miR-647 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-647 | miRNA Mature ID | miR-647 | ||
miRNA Sequence |
GUGGCUGCACUCACUUCCUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 27 |
miR-670 directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-670 | miRNA Mature ID | miR-670-3p | ||
miRNA Sequence |
UUUCCUCAUAUUCAUUCAGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 28 |
miR-6780a directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6780a | miRNA Mature ID | miR-6780a-3p | ||
miRNA Sequence |
CUCCUCUGUUUUCUUUCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 29 |
miR-6881 directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6881 | miRNA Mature ID | miR-6881-3p | ||
miRNA Sequence |
AUCCUCUUUCGUCCUUCCCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 30 |
miR-7111 directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7111 | miRNA Mature ID | miR-7111-3p | ||
miRNA Sequence |
AUCCUCUCUUCCCUCCUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 31 |
miR-8064 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-8064 | miRNA Mature ID | miR-8064 | ||
miRNA Sequence |
AGCACACUGAGCGAGCGGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 32 |
miR-877 directly targets SLC25A25 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-877 | miRNA Mature ID | miR-877-3p | ||
miRNA Sequence |
UCCUCUUCUCCCUCCUCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 33 |
miR-889 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-889 | miRNA Mature ID | miR-889-5p | ||
miRNA Sequence |
AAUGGCUGUCCGUAGUAUGGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 34 |
miR-96 directly targets SLC25A25 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-96 | miRNA Mature ID | miR-96-5p | ||
miRNA Sequence |
UUUGGCACUAGCACAUUUUUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.