Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0190 Transporter Info
Gene Name SLC25A29
Transporter Name Mitochondrial ornithine transporter 3
Gene ID
123096
UniProt ID
Q8N8R3
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg18710929)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.32E+00 Statistic Test p-value: 2.75E-25; Z-score: 6.45E+00

Methylation in Case

 2.25E-01 (Median) Methylation in Control 9.69E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg04012082)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.51E+00 Statistic Test p-value: 2.69E-15; Z-score: -2.53E+00

Methylation in Case

 2.68E-01 (Median) Methylation in Control 4.05E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg15175242)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.15E-08; Z-score: -6.42E-01

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.68E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg01740650)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.89E-03; Z-score: -2.84E-01

Methylation in Case

 8.91E-01 (Median) Methylation in Control 8.96E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg10786489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.46E-02; Z-score: -2.83E-01

Methylation in Case

 8.36E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in hepatocellular carcinoma [ 2 ]

Location

 TSS200 (cg04299028)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.73E+00 Statistic Test p-value: 1.44E-18; Z-score: -5.34E+00

Methylation in Case

 4.03E-01 (Median) Methylation in Control 6.98E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in hepatocellular carcinoma [ 2 ]

Location

 TSS200 (cg21306329)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.45E+00 Statistic Test p-value: 5.49E-15; Z-score: 1.83E+00

Methylation in Case

 6.34E-01 (Median) Methylation in Control 4.39E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg23709172)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.18E+00 Statistic Test p-value: 2.66E-06; Z-score: 1.36E+00

Methylation in Case

 5.55E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.21E-03; Z-score: -3.37E-01

Methylation in Case

 7.01E-01 (Median) Methylation in Control 7.17E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in hepatocellular carcinoma [ 2 ]

Location

 Body (cg14064024)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 3.50E-02; Z-score: 8.91E-01

Methylation in Case

 6.67E-01 (Median) Methylation in Control 6.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A29 in hepatocellular carcinoma [ 2 ]

Location

 3'UTR (cg20929849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.72E-05; Z-score: -1.37E+00

Methylation in Case

 8.12E-01 (Median) Methylation in Control 8.47E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Prostate cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in prostate cancer [ 3 ]

Location

 TSS200 (cg21977075)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.53E+00 Statistic Test p-value: 1.82E-02; Z-score: 2.44E+00

Methylation in Case

 7.37E-01 (Median) Methylation in Control 4.82E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in prostate cancer [ 3 ]

Location

 Body (cg20955989)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.57E+00 Statistic Test p-value: 3.80E-02; Z-score: 6.49E+00

Methylation in Case

 5.17E-01 (Median) Methylation in Control 2.01E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in prostate cancer [ 3 ]

Location

 3'UTR (cg07501827)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 1.54E-03; Z-score: 3.61E+00

Methylation in Case

 8.49E-01 (Median) Methylation in Control 7.50E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Colon cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in colon adenocarcinoma [ 4 ]

Location

 1stExon (cg12348970)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.56E-03; Z-score: -2.60E+00

Methylation in Case

 8.05E-01 (Median) Methylation in Control 8.56E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in colon adenocarcinoma [ 4 ]

Location

 Body (cg13960084)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.97E+00 Statistic Test p-value: 2.03E-07; Z-score: 6.58E+00

Methylation in Case

 4.48E-01 (Median) Methylation in Control 1.51E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in colon adenocarcinoma [ 4 ]

Location

 Body (cg07489029)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 8.61E-04; Z-score: -2.12E+00

Methylation in Case

 8.11E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in colon adenocarcinoma [ 4 ]

Location

 Body (cg11828251)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.97E-03; Z-score: -2.53E+00

Methylation in Case

 7.04E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in colon adenocarcinoma [ 4 ]

Location

 Body (cg12096528)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.46E-03; Z-score: -1.11E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            8 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg01437482)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 6.81E-05; Z-score: 5.98E-01

Methylation in Case

 8.74E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 7.33E-05; Z-score: -1.08E+00

Methylation in Case

 6.31E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg03886017)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.21E+00 Statistic Test p-value: 4.60E-04; Z-score: -7.63E-01

Methylation in Case

 5.82E-01 (Median) Methylation in Control 7.04E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg05043627)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.22E-03; Z-score: -5.53E-01

Methylation in Case

 8.19E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg14064024)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 4.24E-02; Z-score: 3.19E-01

Methylation in Case

 9.04E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A29 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 Body (cg14318489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.49E-02; Z-score: -7.96E-02

Methylation in Case

 4.17E-02 (Median) Methylation in Control 4.36E-02 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC25A29 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 3'UTR (cg15862841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 6.67E-11; Z-score: -1.64E+00

Methylation in Case

 8.30E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC25A29 in atypical teratoid rhabdoid tumor [ 5 ]

Location

 3'UTR (cg20929849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 4.82E-10; Z-score: 1.90E+00

Methylation in Case

 8.37E-01 (Median) Methylation in Control 6.73E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in bladder cancer [ 6 ]

Location

 Body (cg23709172)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.42E+00 Statistic Test p-value: 2.96E-08; Z-score: 7.27E+00

Methylation in Case

 4.98E-01 (Median) Methylation in Control 2.06E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in bladder cancer [ 6 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.43E+00 Statistic Test p-value: 5.11E-08; Z-score: -9.23E+00

Methylation in Case

 5.59E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in bladder cancer [ 6 ]

Location

 Body (cg05043627)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.87E+00 Statistic Test p-value: 9.76E-06; Z-score: -4.45E+00

Methylation in Case

 1.06E-01 (Median) Methylation in Control 1.98E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in bladder cancer [ 6 ]

Location

 Body (cg14064024)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 2.38E-04; Z-score: -3.44E+00

Methylation in Case

 4.28E-01 (Median) Methylation in Control 5.26E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in bladder cancer [ 6 ]

Location

 Body (cg17705681)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.60E-04; Z-score: -7.45E+00

Methylation in Case

 8.93E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A29 in bladder cancer [ 6 ]

Location

 Body (cg18804587)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 6.03E-03; Z-score: 2.15E+00

Methylation in Case

 9.51E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC25A29 in bladder cancer [ 6 ]

Location

 Body (cg24141378)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.07E-02; Z-score: -1.57E+00

Methylation in Case

 8.22E-01 (Median) Methylation in Control 8.38E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC25A29 in bladder cancer [ 6 ]

Location

 Body (cg25906332)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 2.58E-02; Z-score: -1.67E+00

Methylation in Case

 5.08E-02 (Median) Methylation in Control 5.99E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC25A29 in bladder cancer [ 6 ]

Location

 3'UTR (cg20929849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.07E-02; Z-score: -1.25E+00

Methylation in Case

 8.11E-01 (Median) Methylation in Control 8.26E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in breast cancer [ 7 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 1.44E-11; Z-score: -2.56E+00

Methylation in Case

 7.04E-01 (Median) Methylation in Control 7.86E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in breast cancer [ 7 ]

Location

 Body (cg05043627)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.49E+00 Statistic Test p-value: 6.34E-09; Z-score: -1.62E+00

Methylation in Case

 1.21E-01 (Median) Methylation in Control 1.79E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in breast cancer [ 7 ]

Location

 Body (cg23709172)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.20E+00 Statistic Test p-value: 1.20E-07; Z-score: 1.72E+00

Methylation in Case

 2.75E-01 (Median) Methylation in Control 2.28E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in breast cancer [ 7 ]

Location

 Body (cg14064024)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.12E+00 Statistic Test p-value: 5.62E-07; Z-score: -1.23E+00

Methylation in Case

 4.86E-01 (Median) Methylation in Control 5.44E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in breast cancer [ 7 ]

Location

 Body (cg18629527)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 2.88E-05; Z-score: 1.14E+00

Methylation in Case

 1.87E-01 (Median) Methylation in Control 1.40E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A29 in breast cancer [ 7 ]

Location

 3'UTR (cg20929849)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.06E+00 Statistic Test p-value: 1.49E-02; Z-score: 1.66E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 7.96E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg18629527)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.08E+00 Statistic Test p-value: 1.40E-08; Z-score: 2.06E+00

Methylation in Case

 2.16E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg20299151)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 5.49E-03; Z-score: -5.59E-01

Methylation in Case

 9.81E-01 (Median) Methylation in Control 9.82E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg14064024)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.26E-02; Z-score: -1.11E+00

Methylation in Case

 5.87E-01 (Median) Methylation in Control 6.41E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg24141378)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.70E-02; Z-score: -2.89E-01

Methylation in Case

 9.41E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg14318489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.79E-02; Z-score: -1.52E-01

Methylation in Case

 9.81E-01 (Median) Methylation in Control 9.81E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A29 in clear cell renal cell carcinoma [ 8 ]

Location

 Body (cg17705681)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 4.86E-02; Z-score: -3.68E-01

Methylation in Case

 9.74E-01 (Median) Methylation in Control 9.76E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in colorectal cancer [ 9 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.34E-10; Z-score: -4.00E+00

Methylation in Case

 7.56E-01 (Median) Methylation in Control 8.59E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in colorectal cancer [ 9 ]

Location

 Body (cg14318489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.81E-04; Z-score: -1.16E+00

Methylation in Case

 9.76E-01 (Median) Methylation in Control 9.79E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in colorectal cancer [ 9 ]

Location

 Body (cg14064024)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 6.80E-04; Z-score: 1.28E+00

Methylation in Case

 7.01E-01 (Median) Methylation in Control 5.99E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in colorectal cancer [ 9 ]

Location

 Body (cg24141378)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.64E-02; Z-score: -9.23E-02

Methylation in Case

 9.31E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in colorectal cancer [ 9 ]

Location

 Body (cg16073846)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 2.40E-02; Z-score: -5.63E-01

Methylation in Case

 1.89E-02 (Median) Methylation in Control 2.36E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Depression

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in depression [ 10 ]

Location

 Body (cg18804587)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.62E-02; Z-score: 3.54E-01

Methylation in Case

 9.18E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in depression [ 10 ]

Location

 Body (cg14318489)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.19E-02; Z-score: -4.23E-01

Methylation in Case

 9.48E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  HIV infection

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in HIV infection [ 11 ]

Location

 Body (cg14064024)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 8.69E-10; Z-score: 2.10E+00

Methylation in Case

 5.65E-01 (Median) Methylation in Control 4.42E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in HIV infection [ 11 ]

Location

 Body (cg18629527)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.53E+00 Statistic Test p-value: 2.86E-07; Z-score: 1.82E+00

Methylation in Case

 3.10E-01 (Median) Methylation in Control 2.03E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in HIV infection [ 11 ]

Location

 Body (cg23709172)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.39E+00 Statistic Test p-value: 1.11E-05; Z-score: 2.36E+00

Methylation in Case

 3.22E-01 (Median) Methylation in Control 2.31E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in HIV infection [ 11 ]

Location

 Body (cg18804587)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 5.48E-05; Z-score: 5.78E-01

Methylation in Case

 9.62E-01 (Median) Methylation in Control 9.55E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in HIV infection [ 11 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.61E-04; Z-score: -1.51E+00

Methylation in Case

 7.59E-01 (Median) Methylation in Control 8.23E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in lung adenocarcinoma [ 12 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.11E-04; Z-score: -2.65E+00

Methylation in Case

 7.74E-01 (Median) Methylation in Control 8.45E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in lung adenocarcinoma [ 12 ]

Location

 Body (cg18629527)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.52E+00 Statistic Test p-value: 3.51E-03; Z-score: 2.70E+00

Methylation in Case

 3.68E-01 (Median) Methylation in Control 2.43E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in lung adenocarcinoma [ 12 ]

Location

 Body (cg23709172)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 1.08E-02; Z-score: 1.98E+00

Methylation in Case

 2.76E-01 (Median) Methylation in Control 2.20E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in panic disorder [ 13 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 6.00E-03; Z-score: 6.11E-01

Methylation in Case

 2.25E+00 (Median) Methylation in Control 1.95E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in papillary thyroid cancer [ 14 ]

Location

 Body (cg23709172)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 8.51E-05; Z-score: 7.94E-01

Methylation in Case

 1.65E-01 (Median) Methylation in Control 1.43E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in papillary thyroid cancer [ 14 ]

Location

 Body (cg18629527)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 1.56E-03; Z-score: 6.29E-01

Methylation in Case

 1.25E-01 (Median) Methylation in Control 1.04E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in papillary thyroid cancer [ 14 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.76E-02; Z-score: -9.06E-02

Methylation in Case

 7.96E-01 (Median) Methylation in Control 8.00E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A29 in papillary thyroid cancer [ 14 ]

Location

 Body (cg18804587)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 4.27E-02; Z-score: 1.82E-01

Methylation in Case

 9.27E-01 (Median) Methylation in Control 9.25E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A29 in papillary thyroid cancer [ 14 ]

Location

 3'UTR (cg15862841)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.32E-11; Z-score: 1.64E+00

Methylation in Case

 9.32E-01 (Median) Methylation in Control 8.70E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A29 in systemic lupus erythematosus [ 15 ]

Location

 Body (cg18629527)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.07E+00 Statistic Test p-value: 1.47E-02; Z-score: 1.68E-01

Methylation in Case

 3.03E-01 (Median) Methylation in Control 2.84E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A29 in systemic lupus erythematosus [ 15 ]

Location

 Body (cg03886017)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.98E-02; Z-score: -3.20E-02

Methylation in Case

 9.27E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A29 in systemic lupus erythematosus [ 15 ]

Location

 Body (cg01551177)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.70E-02; Z-score: -2.73E-01

Methylation in Case

 7.68E-01 (Median) Methylation in Control 8.01E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-15a directly targets SLC25A29 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-15a miRNA Mature ID miR-15a-5p

miRNA Sequence

 UAGCAGCACAUAAUGGUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-15b directly targets SLC25A29 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-15b miRNA Mature ID miR-15b-5p

miRNA Sequence

 UAGCAGCACAUCAUGGUUUACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-16 directly targets SLC25A29 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-195 directly targets SLC25A29 [ 16 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-195 miRNA Mature ID miR-195-5p

miRNA Sequence

 UAGCAGCACAGAAAUAUUGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
3 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
4 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
5 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
6 DNA Methylation Dynamics in Urological Tumors.
7 Genome-wide Scan for Methylation Profiles in Breast Cancer
8 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
9 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
10 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
11 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
12 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
13 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
14 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
15 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
16 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.