Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0191 Transporter Info | ||||
Gene Name | SLC25A3 | ||||
Transporter Name | Phosphate carrier protein | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
8 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1260b directly targets SLC25A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-1260b | miRNA Mature ID | miR-1260b | ||
miRNA Sequence |
AUCCCACCACUGCCACCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 2 |
miR-148a directly targets SLC25A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-148a | miRNA Mature ID | miR-148a-3p | ||
miRNA Sequence |
UCAGUGCACUACAGAACUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 3 |
miR-17 directly targets SLC25A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-17 | miRNA Mature ID | miR-17-5p | ||
miRNA Sequence |
CAAAGUGCUUACAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-324 directly targets SLC25A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-324 | miRNA Mature ID | miR-324-5p | ||
miRNA Sequence |
CGCAUCCCCUAGGGCAUUGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
miR-425 directly targets SLC25A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-425 | miRNA Mature ID | miR-425-5p | ||
miRNA Sequence |
AAUGACACGAUCACUCCCGUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
miR-744 directly targets SLC25A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-744 | miRNA Mature ID | miR-744-5p | ||
miRNA Sequence |
UGCGGGGCUAGGGCUAACAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-877 directly targets SLC25A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-877 | miRNA Mature ID | miR-877-5p | ||
miRNA Sequence |
GUAGAGGAGAUGGCGCAGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 8 |
miR-92a directly targets SLC25A3 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC25A3 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 6.61E-07; Fold-change: -0.231962095; Z-score: -9.82884682 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
References | |||||
---|---|---|---|---|---|
1 | Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65. | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.