Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0193 Transporter Info
Gene Name SLC25A31
Transporter Name Adenine nucleotide translocator 4
Gene ID
83447
UniProt ID
Q9H0C2
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg26409237)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 2.09E-05; Z-score: 1.21E+00

Methylation in Case

 8.59E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A31 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg06250288)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.50E-03; Z-score: -6.14E-01

Methylation in Case

 7.46E-01 (Median) Methylation in Control 7.81E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A31 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg14778169)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.23E+00 Statistic Test p-value: 9.03E-07; Z-score: -1.29E+00

Methylation in Case

 2.63E-01 (Median) Methylation in Control 3.24E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A31 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS200 (cg25357155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 3.13E-04; Z-score: 1.30E-01

Methylation in Case

 2.56E-02 (Median) Methylation in Control 2.47E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A31 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg26125060)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.53E+00 Statistic Test p-value: 7.52E-08; Z-score: -1.72E+00

Methylation in Case

 1.99E-01 (Median) Methylation in Control 3.04E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A31 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg22110273)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.28E+00 Statistic Test p-value: 1.45E-07; Z-score: 1.70E+00

Methylation in Case

 3.13E-01 (Median) Methylation in Control 1.38E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC25A31 in pancretic ductal adenocarcinoma [ 1 ]

Location

 3'UTR (cg25475999)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 3.36E-07; Z-score: -8.98E-01

Methylation in Case

 7.30E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in bladder cancer [ 2 ]

Location

 TSS1500 (cg01493150)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 3.84E-03; Z-score: -4.04E+00

Methylation in Case

 5.95E-01 (Median) Methylation in Control 6.72E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A31 in bladder cancer [ 2 ]

Location

 Body (cg07294313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 7.54E-03; Z-score: -3.24E+00

Methylation in Case

 8.79E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in breast cancer [ 3 ]

Location

 TSS1500 (cg11060673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 6.90E-05; Z-score: -5.35E-01

Methylation in Case

 7.83E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A31 in breast cancer [ 3 ]

Location

 TSS1500 (cg01493150)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 5.81E-04; Z-score: -9.11E-01

Methylation in Case

 5.02E-01 (Median) Methylation in Control 5.51E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A31 in breast cancer [ 3 ]

Location

 TSS1500 (cg03265826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.15E-02; Z-score: -3.15E-02

Methylation in Case

 9.25E-01 (Median) Methylation in Control 9.26E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A31 in breast cancer [ 3 ]

Location

 TSS200 (cg26983317)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.61E-05; Z-score: -7.79E-01

Methylation in Case

 9.18E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A31 in breast cancer [ 3 ]

Location

 1stExon (cg13649728)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.65E-05; Z-score: -1.24E+00

Methylation in Case

 8.02E-01 (Median) Methylation in Control 8.39E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A31 in breast cancer [ 3 ]

Location

 Body (cg07294313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.57E-03; Z-score: -3.17E-01

Methylation in Case

 8.80E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC25A31 in breast cancer [ 3 ]

Location

 3'UTR (cg10398107)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.11E-04; Z-score: -6.29E-01

Methylation in Case

 8.97E-01 (Median) Methylation in Control 9.13E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg21575465)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.62E-04; Z-score: -1.33E+00

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.47E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A31 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg11060673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 6.01E-03; Z-score: -6.45E-01

Methylation in Case

 9.02E-01 (Median) Methylation in Control 9.14E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A31 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg03265826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.52E-02; Z-score: -6.73E-01

Methylation in Case

 9.84E-01 (Median) Methylation in Control 9.86E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A31 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg23475278)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 7.15E-06; Z-score: -8.68E-01

Methylation in Case

 9.78E-01 (Median) Methylation in Control 9.80E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A31 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg07641839)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 7.02E-05; Z-score: -6.75E-01

Methylation in Case

 9.79E-01 (Median) Methylation in Control 9.81E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A31 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg04382920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 8.35E-05; Z-score: -1.01E+00

Methylation in Case

 9.81E-01 (Median) Methylation in Control 9.82E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC25A31 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg09796800)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 3.30E-02; Z-score: -2.80E-01

Methylation in Case

 9.78E-01 (Median) Methylation in Control 9.79E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg24605304)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.42E+00 Statistic Test p-value: 9.58E-04; Z-score: 2.33E+00

Methylation in Case

 3.56E-01 (Median) Methylation in Control 2.50E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A31 in colon adenocarcinoma [ 5 ]

Location

 Body (cg01792749)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.40E+00 Statistic Test p-value: 5.49E-06; Z-score: -2.06E+00

Methylation in Case

 3.36E-01 (Median) Methylation in Control 4.70E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A31 in colon adenocarcinoma [ 5 ]

Location

 Body (cg03901281)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 2.65E-05; Z-score: -3.68E+00

Methylation in Case

 6.71E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A31 in colon adenocarcinoma [ 5 ]

Location

 Body (cg00704369)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 2.88E-05; Z-score: -2.73E+00

Methylation in Case

 5.24E-01 (Median) Methylation in Control 6.95E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A31 in colon adenocarcinoma [ 5 ]

Location

 Body (cg11378979)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 6.85E-05; Z-score: -1.62E+00

Methylation in Case

 5.38E-01 (Median) Methylation in Control 6.24E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A31 in colon adenocarcinoma [ 5 ]

Location

 Body (cg16526509)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.56E-03; Z-score: -1.35E+00

Methylation in Case

 8.43E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC25A31 in colon adenocarcinoma [ 5 ]

Location

 Body (cg09861436)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 4.81E-03; Z-score: 1.38E+00

Methylation in Case

 7.31E-01 (Median) Methylation in Control 6.48E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg11060673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 5.58E-09; Z-score: -3.58E+00

Methylation in Case

 8.89E-01 (Median) Methylation in Control 9.29E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A31 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg01493150)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 6.12E-08; Z-score: -2.26E+00

Methylation in Case

 6.08E-01 (Median) Methylation in Control 6.91E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A31 in colorectal cancer [ 6 ]

Location

 TSS1500 (cg21575465)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.69E-04; Z-score: -1.71E+00

Methylation in Case

 8.58E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A31 in colorectal cancer [ 6 ]

Location

 TSS200 (cg26983317)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.85E-02; Z-score: -1.73E-01

Methylation in Case

 9.70E-01 (Median) Methylation in Control 9.71E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A31 in colorectal cancer [ 6 ]

Location

 1stExon (cg13649728)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 3.45E-02; Z-score: 1.90E-01

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.32E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A31 in colorectal cancer [ 6 ]

Location

 3'UTR (cg10398107)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.17E-02; Z-score: -1.59E-01

Methylation in Case

 9.26E-01 (Median) Methylation in Control 9.29E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg01493150)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 7.37E-08; Z-score: -2.03E+00

Methylation in Case

 4.54E-01 (Median) Methylation in Control 5.53E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg11060673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 2.21E-07; Z-score: -1.89E+00

Methylation in Case

 7.20E-01 (Median) Methylation in Control 7.68E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 TSS1500 (cg03265826)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 7.46E-07; Z-score: -2.26E+00

Methylation in Case

 8.48E-01 (Median) Methylation in Control 9.03E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 TSS200 (cg26983317)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.16E-06; Z-score: -1.96E+00

Methylation in Case

 8.91E-01 (Median) Methylation in Control 9.20E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 TSS200 (cg09796800)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.41E-04; Z-score: -5.84E-01

Methylation in Case

 9.56E-01 (Median) Methylation in Control 9.66E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 TSS200 (cg04382920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.13E-03; Z-score: -2.87E-01

Methylation in Case

 9.65E-01 (Median) Methylation in Control 9.69E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 TSS200 (cg07641839)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 1.06E-02; Z-score: -2.17E-01

Methylation in Case

 9.60E-01 (Median) Methylation in Control 9.63E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 1stExon (cg13649728)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 3.99E-03; Z-score: 3.83E-04

Methylation in Case

 8.21E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg18031850)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.85E+00 Statistic Test p-value: 3.21E-14; Z-score: 4.22E+00

Methylation in Case

 5.15E-01 (Median) Methylation in Control 2.79E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 Body (cg07294313)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.13E-08; Z-score: -4.50E+00

Methylation in Case

 7.97E-01 (Median) Methylation in Control 8.87E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC25A31 in hepatocellular carcinoma [ 7 ]

Location

 3'UTR (cg10398107)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.57E-07; Z-score: -1.00E+00

Methylation in Case

 7.32E-01 (Median) Methylation in Control 7.98E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg11060673)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.09E-06; Z-score: -1.06E+00

Methylation in Case

 8.68E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A31 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg21575465)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.33E-02; Z-score: -3.26E-01

Methylation in Case

 8.58E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC25A31 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg01493150)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 1.96E-02; Z-score: -7.56E-01

Methylation in Case

 6.64E-01 (Median) Methylation in Control 7.06E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC25A31 in papillary thyroid cancer [ 8 ]

Location

 TSS200 (cg04382920)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 4.38E-02; Z-score: 1.09E-01

Methylation in Case

 9.63E-01 (Median) Methylation in Control 9.62E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC25A31 in papillary thyroid cancer [ 8 ]

Location

 TSS200 (cg23475278)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.00E+00 Statistic Test p-value: 4.51E-02; Z-score: 1.32E-01

Methylation in Case

 9.53E-01 (Median) Methylation in Control 9.51E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in lung adenocarcinoma [ 9 ]

Location

 1stExon (cg13649728)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 1.37E-02; Z-score: -2.08E+00

Methylation in Case

 8.15E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A31 in panic disorder [ 10 ]

Location

 3'UTR (cg10398107)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -5.50E-01 Statistic Test p-value: 3.44E-05; Z-score: -6.38E-01

Methylation in Case

 -4.89E-01 (Median) Methylation in Control -2.69E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-335 directly targets SLC25A31 [ 11 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
7 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
10 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
11 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.