Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0194 Transporter Info
Gene Name SLC25A32
Transporter Name Mitochondrial folate transporter/carrier
Gene ID
81034
UniProt ID
Q9H2D1
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A32 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 Body (cg10011091)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.32E-02; Z-score: 6.15E-01

Methylation in Case

 9.17E-01 (Median) Methylation in Control 8.95E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A32 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg03648734)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 1.23E-14; Z-score: -2.73E+00

Methylation in Case

 6.95E-01 (Median) Methylation in Control 8.61E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A32 in colorectal cancer [ 2 ]

Location

 Body (cg10011091)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.82E-02; Z-score: -5.84E-01

Methylation in Case

 7.97E-01 (Median) Methylation in Control 8.31E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC25A32 in colorectal cancer [ 2 ]

Location

 3'UTR (cg03648734)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.83E-02; Z-score: 5.75E-01

Methylation in Case

 9.52E-01 (Median) Methylation in Control 9.45E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  HIV infection

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A32 in HIV infection [ 3 ]

Location

 Body (cg10011091)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.61E+00 Statistic Test p-value: 7.82E-08; Z-score: 2.58E+00

Methylation in Case

 5.91E-01 (Median) Methylation in Control 3.67E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A32 in hepatocellular carcinoma [ 4 ]

Location

 3'UTR (cg03648734)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 2.63E-02; Z-score: 3.43E-01

Methylation in Case

 8.65E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A32 in panic disorder [ 5 ]

Location

 3'UTR (cg03648734)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -4.26E+00 Statistic Test p-value: 3.61E-02; Z-score: -6.32E-01

Methylation in Case

 7.35E-02 (Median) Methylation in Control 3.13E-01 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC25A32 in papillary thyroid cancer [ 6 ]

Location

 3'UTR (cg03648734)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.34E-03; Z-score: -3.20E-01

Methylation in Case

 9.16E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

          62 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 let-7b directly targets SLC25A32 [ 7 ]

Epigenetic Type

 microRNA Experiment Method pSILAC//Proteomics;Other

miRNA Stemloop ID

 let-7b miRNA Mature ID let-7b-5p

miRNA Sequence

 UGAGGUAGUAGGUUGUGUGGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 2

 miR-1236 directly targets SLC25A32 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1236 miRNA Mature ID miR-1236-3p

miRNA Sequence

 CCUCUUCCCCUUGUCUCUCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-1247 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1247 miRNA Mature ID miR-1247-3p

miRNA Sequence

 CCCCGGGAACGUCGAGACUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-132 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-132 miRNA Mature ID miR-132-3p

miRNA Sequence

 UAACAGUCUACAGCCAUGGUCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-141 directly targets SLC25A32 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-141 miRNA Mature ID miR-141-5p

miRNA Sequence

 CAUCUUCCAGUACAGUGUUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-16 directly targets SLC25A32 [ 7 ]

Epigenetic Type

 microRNA Experiment Method Proteomics

miRNA Stemloop ID

 miR-16 miRNA Mature ID miR-16-5p

miRNA Sequence

 UAGCAGCACGUAAAUAUUGGCG

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 7

 miR-194 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-194 miRNA Mature ID miR-194-5p

miRNA Sequence

 UGUAACAGCAACUCCAUGUGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-212 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-212 miRNA Mature ID miR-212-3p

miRNA Sequence

 UAACAGUCUCCAGUCACGGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-25 directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-25 miRNA Mature ID miR-25-3p

miRNA Sequence

 CAUUGCACUUGUCUCGGUCUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 10

 miR-3137 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3137 miRNA Mature ID miR-3137

miRNA Sequence

 UCUGUAGCCUGGGAGCAAUGGGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-3160 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3160 miRNA Mature ID miR-3160-3p

miRNA Sequence

 AGAGCUGAGACUAGAAAGCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-32 directly targets SLC25A32 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-32 miRNA Mature ID miR-32-5p

miRNA Sequence

 UAUUGCACAUUACUAAGUUGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-339 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-339 miRNA Mature ID miR-339-5p

miRNA Sequence

 UCCCUGUCCUCCAGGAGCUCACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-363 directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-363 miRNA Mature ID miR-363-3p

miRNA Sequence

 AAUUGCACGGUAUCCAUCUGUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 15

 miR-367 directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-367 miRNA Mature ID miR-367-3p

miRNA Sequence

 AAUUGCACUUUAGCAAUGGUGA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 16

 miR-3689d directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3689d miRNA Mature ID miR-3689d

miRNA Sequence

 GGGAGGUGUGAUCUCACACUCG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-377 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-377 miRNA Mature ID miR-377-5p

miRNA Sequence

 AGAGGUUGCCCUUGGUGAAUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-4287 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4287 miRNA Mature ID miR-4287

miRNA Sequence

 UCUCCCUUGAGGGCACUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-4422 directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4422 miRNA Mature ID miR-4422

miRNA Sequence

 AAAAGCAUCAGGAAGUACCCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 20

 miR-4469 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4469 miRNA Mature ID miR-4469

miRNA Sequence

 GCUCCCUCUAGGGUCGCUCGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-4487 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4487 miRNA Mature ID miR-4487

miRNA Sequence

 AGAGCUGGCUGAAGGGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-455 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-455 miRNA Mature ID miR-455-3p

miRNA Sequence

 GCAGUCCAUGGGCAUAUACAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-4676 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4676 miRNA Mature ID miR-4676-5p

miRNA Sequence

 GAGCCAGUGGUGAGACAGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-4685 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4685 miRNA Mature ID miR-4685-3p

miRNA Sequence

 UCUCCCUUCCUGCCCUGGCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-4691 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4691 miRNA Mature ID miR-4691-5p

miRNA Sequence

 GUCCUCCAGGCCAUGAGCUGCGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-4704 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4704 miRNA Mature ID miR-4704-3p

miRNA Sequence

 UCAGUCACAUAUCUAGUGUCUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-4713 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4713 miRNA Mature ID miR-4713-5p

miRNA Sequence

 UUCUCCCACUACCAGGCUCCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-4722 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-5p

miRNA Sequence

 GGCAGGAGGGCUGUGCCAGGUUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 29

 miR-4753 directly targets SLC25A32 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4753 miRNA Mature ID miR-4753-3p

miRNA Sequence

 UUCUCUUUCUUUAGCCUUGUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-4768 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-3p

miRNA Sequence

 CCAGGAGAUCCAGAGAGAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-4768 directly targets SLC25A32 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4768 miRNA Mature ID miR-4768-5p

miRNA Sequence

 AUUCUCUCUGGAUCCCAUGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-4775 directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4775 miRNA Mature ID miR-4775

miRNA Sequence

 UUAAUUUUUUGUUUCGGUCACU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 33

 miR-4795 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4795 miRNA Mature ID miR-4795-3p

miRNA Sequence

 AUAUUAUUAGCCACUUCUGGAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-483 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-483 miRNA Mature ID miR-483-3p

miRNA Sequence

 UCACUCCUCUCCUCCCGUCUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-501 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-501 miRNA Mature ID miR-501-5p

miRNA Sequence

 AAUCCUUUGUCCCUGGGUGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-558 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-558 miRNA Mature ID miR-558

miRNA Sequence

 UGAGCUGCUGUACCAAAAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-5681b directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5681b miRNA Mature ID miR-5681b

miRNA Sequence

 AGGUAUUGCCACCCUUUCUAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 38

 miR-575 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-575 miRNA Mature ID miR-575

miRNA Sequence

 GAGCCAGUUGGACAGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-578 directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-578 miRNA Mature ID miR-578

miRNA Sequence

 CUUCUUGUGCUCUAGGAUUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 40

 miR-590 directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-590 miRNA Mature ID miR-590-3p

miRNA Sequence

 UAAUUUUAUGUAUAAGCUAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 41

 miR-6086 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6086 miRNA Mature ID miR-6086

miRNA Sequence

 GGAGGUUGGGAAGGGCAGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-6134 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6134 miRNA Mature ID miR-6134

miRNA Sequence

 UGAGGUGGUAGGAUGUAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-629 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-629 miRNA Mature ID miR-629-3p

miRNA Sequence

 GUUCUCCCAACGUAAGCCCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-6499 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6499 miRNA Mature ID miR-6499-3p

miRNA Sequence

 AGCAGUGUUUGUUUUGCCCACA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 45

 miR-6515 directly targets SLC25A32 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6515 miRNA Mature ID miR-6515-3p

miRNA Sequence

 UCUCUUCAUCUACCCCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 46

 miR-6516 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6516 miRNA Mature ID miR-6516-5p

miRNA Sequence

 UUUGCAGUAACAGGUGUGAGCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-668 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-668 miRNA Mature ID miR-668-3p

miRNA Sequence

 UGUCACUCGGCUCGGCCCACUAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-6792 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6792 miRNA Mature ID miR-6792-3p

miRNA Sequence

 CUCCUCCACAGCCCCUGCUCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 49

 miR-6799 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6799 miRNA Mature ID miR-6799-5p

miRNA Sequence

 GGGGAGGUGUGCAGGGCUGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 50

 miR-6809 directly targets SLC25A32 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6809 miRNA Mature ID miR-6809-3p

miRNA Sequence

 CUUCUCUUCUCUCCUUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-6833 directly targets SLC25A32 [ 8 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6833 miRNA Mature ID miR-6833-3p

miRNA Sequence

 UUUCUCUCUCCACUUCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-6835 directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6835 miRNA Mature ID miR-6835-3p

miRNA Sequence

 AAAAGCACUUUUCUGUCUCCCAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 53

 miR-6851 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6851 miRNA Mature ID miR-6851-5p

miRNA Sequence

 AGGAGGUGGUACUAGGGGCCAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 54

 miR-6858 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6858 miRNA Mature ID miR-6858-3p

miRNA Sequence

 CAGCCAGCCCCUGCUCACCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 55

 miR-6867 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6867 miRNA Mature ID miR-6867-3p

miRNA Sequence

 CUCUCCCUCUUUACCCACUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-6880 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6880 miRNA Mature ID miR-6880-5p

miRNA Sequence

 UGGUGGAGGAAGAGGGCAGCUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-7113 directly targets SLC25A32 [ 10 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7113 miRNA Mature ID miR-7113-3p

miRNA Sequence

 CCUCCCUGCCCGCCUCUCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 58

 miR-7847 directly targets SLC25A32 [ 9 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-7847 miRNA Mature ID miR-7847-3p

miRNA Sequence

 CGUGGAGGACGAGGAGGAGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 59

 miR-9-3p directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-9-3p miRNA Mature ID miR-9-3p

miRNA Sequence

 AUAAAGCUAGAUAACCGAAAGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 60

 miR-92a directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-92a miRNA Mature ID miR-92a-3p

miRNA Sequence

 UAUUGCACUUGUCCCGGCCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 61

 miR-92b directly targets SLC25A32 [ 11 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-92b miRNA Mature ID miR-92b-3p

miRNA Sequence

 UAUUGCACUCGUCCCGGCCUCC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 62

 miR-98 directly targets SLC25A32 [ 13 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-98 miRNA Mature ID miR-98-5p

miRNA Sequence

 UGAGGUAGUAAGUUGUAUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
3 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
4 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
5 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Widespread changes in protein synthesis induced by microRNAs. Nature. 2008 Sep 4;455(7209):58-63.
8 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
9 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
10 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
11 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
12 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
13 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.