Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0195 Transporter Info
Gene Name	SLC25A33
Transporter Name	Bone marrow stromal cell mitochondrial carrier protein
Gene ID	84275
UniProt ID	Q9BSK2

Epigenetic Regulations of This DT (EGR)
Methylation
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in colon adenocarcinoma			[ 1 ]
Location	5'UTR (cg03835296)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 4.41E-03; Z-score: -1.43E+00
Methylation in Case	8.00E-01 (Median)	Methylation in Control	8.42E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg18329052)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 1.33E-04; Z-score: -1.40E+00
Methylation in Case	5.63E-01 (Median)	Methylation in Control	6.95E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A33 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg24751648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.54E+00	Statistic Test	p-value: 5.95E-04; Z-score: -1.32E+00
Methylation in Case	1.56E-01 (Median)	Methylation in Control	2.40E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A33 in colon adenocarcinoma			[ 1 ]
Location	TSS200 (cg00881552)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.13E+00	Statistic Test	p-value: 7.79E-04; Z-score: 5.42E+00
Methylation in Case	2.30E-01 (Median)	Methylation in Control	1.08E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A33 in colon adenocarcinoma			[ 1 ]
Location	Body (cg11789820)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 4.77E-07; Z-score: -3.19E+00
Methylation in Case	5.65E-01 (Median)	Methylation in Control	7.34E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A33 in colon adenocarcinoma			[ 1 ]
Location	Body (cg06121808)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.30E+00	Statistic Test	p-value: 1.37E-05; Z-score: -2.64E+00
Methylation in Case	4.17E-01 (Median)	Methylation in Control	5.41E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Bladder cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	TSS1500 (cg18783781)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.48E+00	Statistic Test	p-value: 9.15E-08; Z-score: -7.13E+00
Methylation in Case	4.73E-01 (Median)	Methylation in Control	7.01E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	TSS1500 (cg11826452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.15E+00	Statistic Test	p-value: 1.93E-05; Z-score: -3.08E+00
Methylation in Case	5.04E-01 (Median)	Methylation in Control	5.77E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	TSS1500 (cg25369015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -4.32E+00	Statistic Test	p-value: 2.38E-04; Z-score: -4.72E+00
Methylation in Case	2.22E-02 (Median)	Methylation in Control	9.60E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	TSS1500 (cg19896639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.57E+00	Statistic Test	p-value: 1.31E-03; Z-score: -3.11E+00
Methylation in Case	5.54E-02 (Median)	Methylation in Control	8.71E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	TSS1500 (cg13557160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.77E-03; Z-score: -2.01E+00
Methylation in Case	7.84E-01 (Median)	Methylation in Control	8.35E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	TSS200 (cg10009930)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.62E-02; Z-score: -1.09E+00
Methylation in Case	1.44E-01 (Median)	Methylation in Control	1.56E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	TSS200 (cg04621676)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 4.70E-02; Z-score: 8.81E-01
Methylation in Case	4.79E-02 (Median)	Methylation in Control	3.96E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	Body (cg13688474)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.89E+00	Statistic Test	p-value: 5.13E-12; Z-score: -1.21E+01
Methylation in Case	1.26E-01 (Median)	Methylation in Control	2.38E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	Body (cg26607031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.29E+00	Statistic Test	p-value: 1.65E-06; Z-score: 7.37E+00
Methylation in Case	7.59E-01 (Median)	Methylation in Control	2.31E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	Body (cg23824902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 2.85E-04; Z-score: -3.78E+00
Methylation in Case	6.96E-01 (Median)	Methylation in Control	7.69E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	Body (cg06927343)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 4.20E-04; Z-score: -2.26E+00
Methylation in Case	8.57E-01 (Median)	Methylation in Control	8.89E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC25A33 in bladder cancer			[ 2 ]
Location	Body (cg09058554)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 2.45E-03; Z-score: -1.93E+00
Methylation in Case	6.48E-01 (Median)	Methylation in Control	7.38E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	12 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	TSS1500 (cg25369015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -6.66E+00	Statistic Test	p-value: 1.12E-14; Z-score: -1.96E+00
Methylation in Case	3.33E-02 (Median)	Methylation in Control	2.22E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	TSS1500 (cg19896639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -4.28E+00	Statistic Test	p-value: 7.07E-14; Z-score: -1.91E+00
Methylation in Case	5.74E-02 (Median)	Methylation in Control	2.46E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	TSS1500 (cg18783781)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 7.53E-09; Z-score: -1.80E+00
Methylation in Case	6.65E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	TSS1500 (cg11826452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 9.39E-05; Z-score: -1.08E+00
Methylation in Case	5.21E-01 (Median)	Methylation in Control	5.77E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	TSS1500 (cg13557160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.17E+00	Statistic Test	p-value: 1.14E-03; Z-score: -9.97E-01
Methylation in Case	6.95E-01 (Median)	Methylation in Control	8.14E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	TSS200 (cg10009930)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.51E-02; Z-score: -3.01E-01
Methylation in Case	1.44E-01 (Median)	Methylation in Control	1.55E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	Body (cg13688474)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.17E+00	Statistic Test	p-value: 1.02E-27; Z-score: -3.52E+00
Methylation in Case	1.41E-01 (Median)	Methylation in Control	3.05E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	Body (cg26607031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.71E+00	Statistic Test	p-value: 7.67E-24; Z-score: 5.18E+00
Methylation in Case	4.98E-01 (Median)	Methylation in Control	1.84E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	Body (cg13631913)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -4.46E+00	Statistic Test	p-value: 7.50E-16; Z-score: -2.11E+00
Methylation in Case	5.44E-02 (Median)	Methylation in Control	2.43E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	Body (cg03901886)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.55E+01	Statistic Test	p-value: 2.03E-12; Z-score: -1.67E+00
Methylation in Case	1.55E-02 (Median)	Methylation in Control	2.39E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	Body (cg09058554)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 2.64E-07; Z-score: -1.28E+00
Methylation in Case	5.87E-01 (Median)	Methylation in Control	6.57E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC25A33 in breast cancer			[ 3 ]
Location	Body (cg23824902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 9.30E-06; Z-score: -1.31E+00
Methylation in Case	8.11E-01 (Median)	Methylation in Control	8.59E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg25369015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.52E+00	Statistic Test	p-value: 5.96E-04; Z-score: 3.71E+00
Methylation in Case	3.51E-02 (Median)	Methylation in Control	2.32E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in clear cell renal cell carcinoma			[ 4 ]
Location	TSS1500 (cg19896639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.28E+00	Statistic Test	p-value: 3.65E-03; Z-score: 1.39E+00
Methylation in Case	3.44E-02 (Median)	Methylation in Control	2.68E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A33 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg09058554)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.22E+00	Statistic Test	p-value: 1.10E-07; Z-score: 3.25E+00
Methylation in Case	9.17E-01 (Median)	Methylation in Control	7.51E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A33 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg13688474)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.32E+00	Statistic Test	p-value: 2.57E-05; Z-score: 2.04E+00
Methylation in Case	2.54E-01 (Median)	Methylation in Control	1.92E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A33 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg13631913)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 4.95E-03; Z-score: 3.01E-01
Methylation in Case	2.74E-02 (Median)	Methylation in Control	2.54E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A33 in clear cell renal cell carcinoma			[ 4 ]
Location	Body (cg03901886)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 3.01E-02; Z-score: 1.22E+00
Methylation in Case	3.16E-02 (Median)	Methylation in Control	2.67E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg13557160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 9.17E-10; Z-score: -2.62E+00
Methylation in Case	7.86E-01 (Median)	Methylation in Control	8.93E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg11826452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 4.19E-03; Z-score: -7.84E-01
Methylation in Case	7.52E-01 (Median)	Methylation in Control	8.07E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A33 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg02360478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.33E-02; Z-score: -4.47E-01
Methylation in Case	9.10E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A33 in colorectal cancer			[ 5 ]
Location	TSS1500 (cg25369015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.33E+00	Statistic Test	p-value: 3.01E-02; Z-score: -2.96E-01
Methylation in Case	2.08E-02 (Median)	Methylation in Control	2.76E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A33 in colorectal cancer			[ 5 ]
Location	TSS200 (cg10009930)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 2.50E-05; Z-score: 1.20E+00
Methylation in Case	1.56E-01 (Median)	Methylation in Control	1.36E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A33 in colorectal cancer			[ 5 ]
Location	Body (cg26607031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.33E+00	Statistic Test	p-value: 3.93E-06; Z-score: 1.25E+00
Methylation in Case	5.39E-01 (Median)	Methylation in Control	4.07E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A33 in colorectal cancer			[ 5 ]
Location	Body (cg09058554)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.34E-03; Z-score: -5.13E-01
Methylation in Case	7.41E-01 (Median)	Methylation in Control	7.71E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	8 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg13557160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.16E+00	Statistic Test	p-value: 4.42E-08; Z-score: -1.74E+00
Methylation in Case	7.30E-01 (Median)	Methylation in Control	8.45E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg18783781)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 5.94E-08; Z-score: -1.80E+00
Methylation in Case	5.63E-01 (Median)	Methylation in Control	6.82E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A33 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg25369015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.23E+00	Statistic Test	p-value: 1.86E-03; Z-score: -5.03E-01
Methylation in Case	2.56E-02 (Median)	Methylation in Control	3.15E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A33 in hepatocellular carcinoma			[ 6 ]
Location	TSS1500 (cg02360478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.65E-02; Z-score: -4.86E-01
Methylation in Case	8.31E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A33 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg25370753)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -2.29E+00	Statistic Test	p-value: 3.74E-22; Z-score: -1.50E+01
Methylation in Case	3.93E-01 (Median)	Methylation in Control	9.01E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A33 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg13631913)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 4.62E-06; Z-score: -6.64E-01
Methylation in Case	6.58E-02 (Median)	Methylation in Control	7.96E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A33 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg26607031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.38E+00	Statistic Test	p-value: 1.64E-03; Z-score: -7.91E-01
Methylation in Case	2.33E-01 (Median)	Methylation in Control	3.21E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A33 in hepatocellular carcinoma			[ 6 ]
Location	Body (cg23824902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.00E+00	Statistic Test	p-value: 2.06E-02; Z-score: 1.96E-02
Methylation in Case	8.11E-01 (Median)	Methylation in Control	8.10E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg25507121)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.27E+00	Statistic Test	p-value: 1.57E-09; Z-score: -1.63E+00
Methylation in Case	4.79E-01 (Median)	Methylation in Control	6.10E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS200 (cg17653824)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.98E+00	Statistic Test	p-value: 6.30E-19; Z-score: 3.15E+00
Methylation in Case	3.57E-01 (Median)	Methylation in Control	1.81E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A33 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS200 (cg24697682)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.13E+00	Statistic Test	p-value: 4.22E-03; Z-score: -7.03E-01
Methylation in Case	7.77E-02 (Median)	Methylation in Control	8.80E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A33 in pancretic ductal adenocarcinoma			[ 7 ]
Location	1stExon (cg00364611)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 7.51E-05; Z-score: -2.17E-01
Methylation in Case	8.48E-02 (Median)	Methylation in Control	8.91E-02 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A33 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg22334665)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.49E+00	Statistic Test	p-value: 6.74E-07; Z-score: 1.31E+00
Methylation in Case	2.98E-01 (Median)	Methylation in Control	2.00E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A33 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg01440070)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.39E-02; Z-score: 6.17E-01
Methylation in Case	6.91E-01 (Median)	Methylation in Control	6.56E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in panic disorder			[ 8 ]
Location	TSS1500 (cg18783781)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 2.28E-02; Z-score: 2.20E-01
Methylation in Case	2.65E+00 (Median)	Methylation in Control	2.56E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg19896639)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.49E+00	Statistic Test	p-value: 4.05E-10; Z-score: 2.07E+00
Methylation in Case	2.13E-01 (Median)	Methylation in Control	1.43E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg13557160)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 1.68E-09; Z-score: 1.47E+00
Methylation in Case	8.11E-01 (Median)	Methylation in Control	7.74E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A33 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg25369015)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.37E+00	Statistic Test	p-value: 1.71E-07; Z-score: 1.33E+00
Methylation in Case	1.80E-01 (Median)	Methylation in Control	1.31E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A33 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg11826452)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 9.57E-04; Z-score: 7.28E-01
Methylation in Case	5.25E-01 (Median)	Methylation in Control	5.00E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A33 in papillary thyroid cancer			[ 9 ]
Location	Body (cg26607031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.38E+00	Statistic Test	p-value: 1.09E-07; Z-score: 1.43E+00
Methylation in Case	3.49E-01 (Median)	Methylation in Control	2.54E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A33 in papillary thyroid cancer			[ 9 ]
Location	Body (cg13688474)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 1.22E-05; Z-score: 1.02E+00
Methylation in Case	2.07E-01 (Median)	Methylation in Control	1.74E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A33 in papillary thyroid cancer			[ 9 ]
Location	Body (cg09058554)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.68E-03; Z-score: 8.08E-01
Methylation in Case	8.30E-01 (Median)	Methylation in Control	7.89E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A33 in papillary thyroid cancer			[ 9 ]
Location	Body (cg13631913)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.42E-02; Z-score: -7.19E-02
Methylation in Case	7.68E-02 (Median)	Methylation in Control	7.79E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A33 in papillary thyroid cancer			[ 9 ]
Location	Body (cg23824902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 3.90E-02; Z-score: 3.57E-01
Methylation in Case	9.05E-01 (Median)	Methylation in Control	8.96E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	7 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in prostate cancer			[ 10 ]
Location	TSS1500 (cg20677436)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.36E+00	Statistic Test	p-value: 1.06E-02; Z-score: -2.07E+00
Methylation in Case	4.14E-01 (Median)	Methylation in Control	5.62E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in prostate cancer			[ 10 ]
Location	TSS1500 (cg03483626)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.24E+00	Statistic Test	p-value: 1.50E-02; Z-score: 1.61E+00
Methylation in Case	7.65E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A33 in prostate cancer			[ 10 ]
Location	TSS200 (cg04963424)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.99E+00	Statistic Test	p-value: 7.86E-03; Z-score: -2.56E+00
Methylation in Case	2.40E-01 (Median)	Methylation in Control	4.78E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A33 in prostate cancer			[ 10 ]
Location	TSS200 (cg16829998)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 9.13E-03; Z-score: -2.84E+00
Methylation in Case	1.13E-01 (Median)	Methylation in Control	1.72E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A33 in prostate cancer			[ 10 ]
Location	Body (cg20241270)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 2.15E-03; Z-score: 5.14E+00
Methylation in Case	9.48E-01 (Median)	Methylation in Control	9.02E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A33 in prostate cancer			[ 10 ]
Location	Body (cg13767768)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.31E+00	Statistic Test	p-value: 2.63E-03; Z-score: 5.02E+00
Methylation in Case	8.96E-01 (Median)	Methylation in Control	6.82E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A33 in prostate cancer			[ 10 ]
Location	Body (cg20730619)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 3.87E-02; Z-score: 1.63E+00
Methylation in Case	9.30E-01 (Median)	Methylation in Control	8.81E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	2 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A33 in lung adenocarcinoma			[ 11 ]
Location	Body (cg26607031)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.65E+00	Statistic Test	p-value: 2.74E-04; Z-score: 5.96E+00
Methylation in Case	6.18E-01 (Median)	Methylation in Control	3.75E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A33 in lung adenocarcinoma			[ 11 ]
Location	Body (cg23824902)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 1.72E-03; Z-score: 1.81E+00
Methylation in Case	8.39E-01 (Median)	Methylation in Control	7.41E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	100 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-101 directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-101	miRNA Mature ID	miR-101-3p
miRNA Sequence	UACAGUACUGUGAUAACUGAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-106a directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-106a	miRNA Mature ID	miR-106a-5p
miRNA Sequence	AAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-106b directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-106b	miRNA Mature ID	miR-106b-5p
miRNA Sequence	UAAAGUGCUGACAGUGCAGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-122 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-122	miRNA Mature ID	miR-122-5p
miRNA Sequence	UGGAGUGUGACAAUGGUGUUUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-1234 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1234	miRNA Mature ID	miR-1234-3p
miRNA Sequence	UCGGCCUGACCACCCACCCCAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-1268a directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1268a	miRNA Mature ID	miR-1268a
miRNA Sequence	CGGGCGUGGUGGUGGGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-1268b directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1268b	miRNA Mature ID	miR-1268b
miRNA Sequence	CGGGCGUGGUGGUGGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-1289 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1289	miRNA Mature ID	miR-1289
miRNA Sequence	UGGAGUCCAGGAAUCUGCAUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-129 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-129	miRNA Mature ID	miR-129-5p
miRNA Sequence	CUUUUUGCGGUCUGGGCUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-1304 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1304	miRNA Mature ID	miR-1304-3p
miRNA Sequence	UCUCACUGUAGCCUCGAACCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-1304 directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1304	miRNA Mature ID	miR-1304-5p
miRNA Sequence	UUUGAGGCUACAGUGAGAUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-134 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-134	miRNA Mature ID	miR-134-3p
miRNA Sequence	CCUGUGGGCCACCUAGUCACCAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-143 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-143	miRNA Mature ID	miR-143-3p
miRNA Sequence	UGAGAUGAAGCACUGUAGCUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-143 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-143	miRNA Mature ID	miR-143-5p
miRNA Sequence	GGUGCAGUGCUGCAUCUCUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-17 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-17	miRNA Mature ID	miR-17-5p
miRNA Sequence	CAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-186 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-186	miRNA Mature ID	miR-186-3p
miRNA Sequence	GCCCAAAGGUGAAUUUUUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-193b directly targets SLC25A33			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-193b	miRNA Mature ID	miR-193b-3p
miRNA Sequence	AACUGGCCCUCAAAGUCCCGCU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 18	miR-1976 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1976	miRNA Mature ID	miR-1976
miRNA Sequence	CCUCCUGCCCUCCUUGCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-20a directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20a	miRNA Mature ID	miR-20a-5p
miRNA Sequence	UAAAGUGCUUAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-20b directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-20b	miRNA Mature ID	miR-20b-5p
miRNA Sequence	CAAAGUGCUCAUAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-2116 directly targets SLC25A33			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2116	miRNA Mature ID	miR-2116-5p
miRNA Sequence	GGUUCUUAGCAUAGGAGGUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-22 directly targets SLC25A33			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-22	miRNA Mature ID	miR-22-5p
miRNA Sequence	AGUUCUUCAGUGGCAAGCUUUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-2276 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2276	miRNA Mature ID	miR-2276-3p
miRNA Sequence	UCUGCAAGUGUCAGAGGCGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-26b directly targets SLC25A33			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-26b	miRNA Mature ID	miR-26b-3p
miRNA Sequence	CCUGUUCUCCAUUACUUGGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-302a directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302a	miRNA Mature ID	miR-302a-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUUGGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-302b directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302b	miRNA Mature ID	miR-302b-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUUAGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-302c directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302c	miRNA Mature ID	miR-302c-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUCAGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-302d directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302d	miRNA Mature ID	miR-302d-3p
miRNA Sequence	UAAGUGCUUCCAUGUUUGAGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-302e directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302e	miRNA Mature ID	miR-302e
miRNA Sequence	UAAGUGCUUCCAUGCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-3115 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3115	miRNA Mature ID	miR-3115
miRNA Sequence	AUAUGGGUUUACUAGUUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-3135b directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3135b	miRNA Mature ID	miR-3135b
miRNA Sequence	GGCUGGAGCGAGUGCAGUGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-3136 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3136	miRNA Mature ID	miR-3136-3p
miRNA Sequence	UGGCCCAACCUAUUCAGUUAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-3198 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3198	miRNA Mature ID	miR-3198
miRNA Sequence	GUGGAGUCCUGGGGAAUGGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-3199 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3199	miRNA Mature ID	miR-3199
miRNA Sequence	AGGGACUGCCUUAGGAGAAAGUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-3652 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3652	miRNA Mature ID	miR-3652
miRNA Sequence	CGGCUGGAGGUGUGAGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-365a directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-365a	miRNA Mature ID	miR-365a-5p
miRNA Sequence	AGGGACUUUUGGGGGCAGAUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-365b directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-365b	miRNA Mature ID	miR-365b-5p
miRNA Sequence	AGGGACUUUCAGGGGCAGCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 38	miR-372 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-372	miRNA Mature ID	miR-372-3p
miRNA Sequence	AAAGUGCUGCGACAUUUGAGCGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 39	miR-373 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-373	miRNA Mature ID	miR-373-3p
miRNA Sequence	GAAGUGCUUCGAUUUUGGGGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 40	miR-377 directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-377	miRNA Mature ID	miR-377-5p
miRNA Sequence	AGAGGUUGCCCUUGGUGAAUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-4279 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4279	miRNA Mature ID	miR-4279
miRNA Sequence	CUCUCCUCCCGGCUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 42	miR-4294 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4294	miRNA Mature ID	miR-4294
miRNA Sequence	GGGAGUCUACAGCAGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 43	miR-4309 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4309	miRNA Mature ID	miR-4309
miRNA Sequence	CUGGAGUCUAGGAUUCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 44	miR-4430 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4430	miRNA Mature ID	miR-4430
miRNA Sequence	AGGCUGGAGUGAGCGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 45	miR-4433a directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4433a	miRNA Mature ID	miR-4433a-3p
miRNA Sequence	ACAGGAGUGGGGGUGGGACAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 46	miR-4485 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4485	miRNA Mature ID	miR-4485-5p
miRNA Sequence	ACCGCCUGCCCAGUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 47	miR-4534 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4534	miRNA Mature ID	miR-4534
miRNA Sequence	GGAUGGAGGAGGGGUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 48	miR-4639 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4639	miRNA Mature ID	miR-4639-3p
miRNA Sequence	UCACUCUCACCUUGCUUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 49	miR-4677 directly targets SLC25A33			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4677	miRNA Mature ID	miR-4677-5p
miRNA Sequence	UUGUUCUUUGGUCUUUCAGCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 50	miR-4708 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4708	miRNA Mature ID	miR-4708-5p
miRNA Sequence	AGAGAUGCCGCCUUGCUCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 51	miR-4722 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4722	miRNA Mature ID	miR-4722-3p
miRNA Sequence	ACCUGCCAGCACCUCCCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 52	miR-4731 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4731	miRNA Mature ID	miR-4731-5p
miRNA Sequence	UGCUGGGGGCCACAUGAGUGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 53	miR-4740 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4740	miRNA Mature ID	miR-4740-3p
miRNA Sequence	GCCCGAGAGGAUCCGUCCCUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 54	miR-4770 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4770	miRNA Mature ID	miR-4770
miRNA Sequence	UGAGAUGACACUGUAGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 55	miR-5001 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5001	miRNA Mature ID	miR-5001-3p
miRNA Sequence	UUCUGCCUCUGUCCAGGUCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 56	miR-504 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-504	miRNA Mature ID	miR-504-3p
miRNA Sequence	GGGAGUGCAGGGCAGGGUUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 57	miR-5089 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5089	miRNA Mature ID	miR-5089-5p
miRNA Sequence	GUGGGAUUUCUGAGUAGCAUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 58	miR-512 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-512	miRNA Mature ID	miR-512-3p
miRNA Sequence	AAGUGCUGUCAUAGCUGAGGUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 59	miR-519d directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-519d	miRNA Mature ID	miR-519d-3p
miRNA Sequence	CAAAGUGCCUCCCUUUAGAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 60	miR-520a directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520a	miRNA Mature ID	miR-520a-3p
miRNA Sequence	AAAGUGCUUCCCUUUGGACUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 61	miR-520c directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520c	miRNA Mature ID	miR-520c-3p
miRNA Sequence	AAAGUGCUUCCUUUUAGAGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 62	miR-520d directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520d	miRNA Mature ID	miR-520d-3p
miRNA Sequence	AAAGUGCUUCUCUUUGGUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 63	miR-520g directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520g	miRNA Mature ID	miR-520g-3p
miRNA Sequence	ACAAAGUGCUUCCCUUUAGAGUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 64	miR-520h directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-520h	miRNA Mature ID	miR-520h
miRNA Sequence	ACAAAGUGCUUCCCUUUAGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 65	miR-526b directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-526b	miRNA Mature ID	miR-526b-3p
miRNA Sequence	GAAAGUGCUUCCUUUUAGAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 66	miR-5589 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5589	miRNA Mature ID	miR-5589-5p
miRNA Sequence	GGCUGGGUGCUCUUGUGCAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 67	miR-5693 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5693	miRNA Mature ID	miR-5693
miRNA Sequence	GCAGUGGCUCUGAAAUGAACUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 68	miR-5698 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5698	miRNA Mature ID	miR-5698
miRNA Sequence	UGGGGGAGUGCAGUGAUUGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 69	miR-582 directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-582	miRNA Mature ID	miR-582-5p
miRNA Sequence	UUACAGUUGUUCAACCAGUUACU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 70	miR-6086 directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6086	miRNA Mature ID	miR-6086
miRNA Sequence	GGAGGUUGGGAAGGGCAGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 71	miR-6088 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6088	miRNA Mature ID	miR-6088
miRNA Sequence	AGAGAUGAAGCGGGGGGGCG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 72	miR-610 directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-610	miRNA Mature ID	miR-610
miRNA Sequence	UGAGCUAAAUGUGUGCUGGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 73	miR-619 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-619	miRNA Mature ID	miR-619-5p
miRNA Sequence	GCUGGGAUUACAGGCAUGAGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 74	miR-6499 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6499	miRNA Mature ID	miR-6499-3p
miRNA Sequence	AGCAGUGUUUGUUUUGCCCACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 75	miR-6506 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6506	miRNA Mature ID	miR-6506-5p
miRNA Sequence	ACUGGGAUGUCACUGAAUAUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 76	miR-6514 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6514	miRNA Mature ID	miR-6514-5p
miRNA Sequence	UAUGGAGUGGACUUUCAGCUGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 77	miR-655 directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-655	miRNA Mature ID	miR-655-5p
miRNA Sequence	AGAGGUUAUCCGUGUUAUGUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 78	miR-663b directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-663b	miRNA Mature ID	miR-663b
miRNA Sequence	GGUGGCCCGGCCGUGCCUGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 79	miR-665 directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-665	miRNA Mature ID	miR-665
miRNA Sequence	ACCAGGAGGCUGAGGCCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 80	miR-6716 directly targets SLC25A33			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6716	miRNA Mature ID	miR-6716-5p
miRNA Sequence	UGGGAAUGGGGGUAAGGGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 81	miR-6727 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6727	miRNA Mature ID	miR-6727-3p
miRNA Sequence	UCCUGCCACCUCCUCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 82	miR-6736 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6736	miRNA Mature ID	miR-6736-3p
miRNA Sequence	UCAGCUCCUCUCUACCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 83	miR-6741 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6741	miRNA Mature ID	miR-6741-5p
miRNA Sequence	GUGGGUGCUGGUGGGAGCCGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 84	miR-6747 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6747	miRNA Mature ID	miR-6747-3p
miRNA Sequence	UCCUGCCUUCCUCUGCACCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 85	miR-6778 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6778	miRNA Mature ID	miR-6778-3p
miRNA Sequence	UGCCUCCCUGACAUUCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 86	miR-6787 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6787	miRNA Mature ID	miR-6787-3p
miRNA Sequence	UCUCAGCUGCUGCCCUCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 87	miR-6789 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6789	miRNA Mature ID	miR-6789-3p
miRNA Sequence	CGGCGCCCGUGUCUCCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 88	miR-6794 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6794	miRNA Mature ID	miR-6794-3p
miRNA Sequence	CUCACUCUCAGUCCCUCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 89	miR-6840 directly targets SLC25A33			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6840	miRNA Mature ID	miR-6840-3p
miRNA Sequence	GCCCAGGACUUUGUGCGGGGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 90	miR-6890 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6890	miRNA Mature ID	miR-6890-3p
miRNA Sequence	CCACUGCCUAUGCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 91	miR-7107 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7107	miRNA Mature ID	miR-7107-5p
miRNA Sequence	UCGGCCUGGGGAGGAGGAAGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 92	miR-7108 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7108	miRNA Mature ID	miR-7108-5p
miRNA Sequence	GUGUGGCCGGCAGGCGGGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 93	miR-7114 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7114	miRNA Mature ID	miR-7114-5p
miRNA Sequence	UCUGUGGAGUGGGGUGCCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 94	miR-7155 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7155	miRNA Mature ID	miR-7155-3p
miRNA Sequence	UGGCCCAAGACCUCAGACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 95	miR-8052 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8052	miRNA Mature ID	miR-8052
miRNA Sequence	CGGGACUGUAGAGGGCAUGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 96	miR-8055 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8055	miRNA Mature ID	miR-8055
miRNA Sequence	CUUUGAGCACAUGAGCAGACGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 97	miR-8082 directly targets SLC25A33			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-8082	miRNA Mature ID	miR-8082
miRNA Sequence	UGAUGGAGCUGGGAAUACUCUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 98	miR-92a directly targets SLC25A33			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-92a	miRNA Mature ID	miR-92a-3p
miRNA Sequence	UAUUGCACUUGUCCCGGCCUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 99	miR-93 directly targets SLC25A33			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-93	miRNA Mature ID	miR-93-5p
miRNA Sequence	CAAAGUGCUGUUCGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 100	miR-943 directly targets SLC25A33			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-943	miRNA Mature ID	miR-943
miRNA Sequence	CUGACUGUUGCCGUCCUCCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human

References
1	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
2	DNA Methylation Dynamics in Urological Tumors.
3	Genome-wide Scan for Methylation Profiles in Breast Cancer
4	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
12	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
13	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
14	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
15	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
16	Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence