Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0198 Transporter Info | ||||
Gene Name | SLC25A36 | ||||
Transporter Name | Solute carrier family 25 member 36 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
69 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-124 directly targets SLC25A36 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 2 |
miR-1253 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1253 | miRNA Mature ID | miR-1253 | ||
miRNA Sequence |
AGAGAAGAAGAUCAGCCUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 3 |
miR-1273h directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1273h | miRNA Mature ID | miR-1273h-3p | ||
miRNA Sequence |
CUGCAGACUCGACCUCCCAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-1297 directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1297 | miRNA Mature ID | miR-1297 | ||
miRNA Sequence |
UUCAAGUAAUUCAGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
miR-154 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-154 | miRNA Mature ID | miR-154-5p | ||
miRNA Sequence |
UAGGUUAUCCGUGUUGCCUUCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-187 directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-187 | miRNA Mature ID | miR-187-5p | ||
miRNA Sequence |
GGCUACAACACAGGACCCGGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-218 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-218 | miRNA Mature ID | miR-218-5p | ||
miRNA Sequence |
UUGUGCUUGAUCUAACCAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 8 |
miR-221 directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-221 | miRNA Mature ID | miR-221-3p | ||
miRNA Sequence |
AGCUACAUUGUCUGCUGGGUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 9 |
miR-222 directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-222 | miRNA Mature ID | miR-222-3p | ||
miRNA Sequence |
AGCUACAUCUGGCUACUGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 10 |
miR-25 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-25 | miRNA Mature ID | miR-25-3p | ||
miRNA Sequence |
CAUUGCACUUGUCUCGGUCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 11 |
miR-26a directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-26a | miRNA Mature ID | miR-26a-5p | ||
miRNA Sequence |
UUCAAGUAAUCCAGGAUAGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 12 |
miR-26b directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 13 |
miR-3134 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3134 | miRNA Mature ID | miR-3134 | ||
miRNA Sequence |
UGAUGGAUAAAAGACUACAUAUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-3146 directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3146 | miRNA Mature ID | miR-3146 | ||
miRNA Sequence |
CAUGCUAGGAUAGAAAGAAUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 15 |
miR-3148 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3148 | miRNA Mature ID | miR-3148 | ||
miRNA Sequence |
UGGAAAAAACUGGUGUGUGCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 16 |
miR-3153 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3153 | miRNA Mature ID | miR-3153 | ||
miRNA Sequence |
GGGGAAAGCGAGUAGGGACAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-3162 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3162 | miRNA Mature ID | miR-3162-5p | ||
miRNA Sequence |
UUAGGGAGUAGAAGGGUGGGGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 18 |
miR-32 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-32 | miRNA Mature ID | miR-32-5p | ||
miRNA Sequence |
UAUUGCACAUUACUAAGUUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 19 |
miR-3200 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3200 | miRNA Mature ID | miR-3200-5p | ||
miRNA Sequence |
AAUCUGAGAAGGCGCACAAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 20 |
miR-363 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-363 | miRNA Mature ID | miR-363-3p | ||
miRNA Sequence |
AAUUGCACGGUAUCCAUCUGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 21 |
miR-3650 directly targets SLC25A36 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3650 | miRNA Mature ID | miR-3650 | ||
miRNA Sequence |
AGGUGUGUCUGUAGAGUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-367 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-367 | miRNA Mature ID | miR-367-3p | ||
miRNA Sequence |
AAUUGCACUUUAGCAAUGGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 23 |
miR-3678 directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3678 | miRNA Mature ID | miR-3678-3p | ||
miRNA Sequence |
CUGCAGAGUUUGUACGGACCGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 24 |
miR-4302 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4302 | miRNA Mature ID | miR-4302 | ||
miRNA Sequence |
CCAGUGUGGCUCAGCGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-4326 directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4326 | miRNA Mature ID | miR-4326 | ||
miRNA Sequence |
UGUUCCUCUGUCUCCCAGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 26 |
miR-4426 directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4426 | miRNA Mature ID | miR-4426 | ||
miRNA Sequence |
GAAGAUGGACGUACUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 27 |
miR-4434 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4434 | miRNA Mature ID | miR-4434 | ||
miRNA Sequence |
AGGAGAAGUAAAGUAGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 28 |
miR-4465 directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4465 | miRNA Mature ID | miR-4465 | ||
miRNA Sequence |
CUCAAGUAGUCUGACCAGGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 29 |
miR-4480 directly targets SLC25A36 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4480 | miRNA Mature ID | miR-4480 | ||
miRNA Sequence |
AGCCAAGUGGAAGUUACUUUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 30 |
miR-4506 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4506 | miRNA Mature ID | miR-4506 | ||
miRNA Sequence |
AAAUGGGUGGUCUGAGGCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 31 |
miR-4516 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4516 | miRNA Mature ID | miR-4516 | ||
miRNA Sequence |
GGGAGAAGGGUCGGGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 32 |
miR-4531 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4531 | miRNA Mature ID | miR-4531 | ||
miRNA Sequence |
AUGGAGAAGGCUUCUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 33 |
miR-4534 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4534 | miRNA Mature ID | miR-4534 | ||
miRNA Sequence |
GGAUGGAGGAGGGGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 34 |
miR-4647 directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4647 | miRNA Mature ID | miR-4647 | ||
miRNA Sequence |
GAAGAUGGUGCUGUGCUGAGGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 35 |
miR-4662b directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4662b | miRNA Mature ID | miR-4662b | ||
miRNA Sequence |
AAAGAUGGACAAUUGGCUAAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 36 |
miR-4668 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4668 | miRNA Mature ID | miR-4668-5p | ||
miRNA Sequence |
AGGGAAAAAAAAAAGGAUUUGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 37 |
miR-4682 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4682 | miRNA Mature ID | miR-4682 | ||
miRNA Sequence |
UCUGAGUUCCUGGAGCCUGGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 38 |
miR-4753 directly targets SLC25A36 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4753 | miRNA Mature ID | miR-4753-5p | ||
miRNA Sequence |
CAAGGCCAAAGGAAGAGAACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 39 |
miR-4803 directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4803 | miRNA Mature ID | miR-4803 | ||
miRNA Sequence |
UAACAUAAUAGUGUGGAUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 40 |
miR-5094 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5094 | miRNA Mature ID | miR-5094 | ||
miRNA Sequence |
AAUCAGUGAAUGCCUUGAACCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 41 |
miR-5197 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5197 | miRNA Mature ID | miR-5197-3p | ||
miRNA Sequence |
AAGAAGAGACUGAGUCAUCGAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 42 |
miR-548az directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548az | miRNA Mature ID | miR-548az-5p | ||
miRNA Sequence |
CAAAAGUGAUUGUGGUUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 43 |
miR-548c directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548c | miRNA Mature ID | miR-548c-3p | ||
miRNA Sequence |
CAAAAAUCUCAAUUACUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 44 |
miR-548n directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548n | miRNA Mature ID | miR-548n | ||
miRNA Sequence |
CAAAAGUAAUUGUGGAUUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 45 |
miR-548t directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548t | miRNA Mature ID | miR-548t-5p | ||
miRNA Sequence |
CAAAAGUGAUCGUGGUUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 46 |
miR-548v directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548v | miRNA Mature ID | miR-548v | ||
miRNA Sequence |
AGCUACAGUUACUUUUGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 47 |
miR-5584 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5584 | miRNA Mature ID | miR-5584-5p | ||
miRNA Sequence |
CAGGGAAAUGGGAAGAACUAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 48 |
miR-569 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-569 | miRNA Mature ID | miR-569 | ||
miRNA Sequence |
AGUUAAUGAAUCCUGGAAAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 49 |
miR-5690 directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5690 | miRNA Mature ID | miR-5690 | ||
miRNA Sequence |
UCAGCUACUACCUCUAUUAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 50 |
miR-5692a directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5692a | miRNA Mature ID | miR-5692a | ||
miRNA Sequence |
CAAAUAAUACCACAGUGGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 51 |
miR-5697 directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5697 | miRNA Mature ID | miR-5697 | ||
miRNA Sequence |
UCAAGUAGUUUCAUGAUAAAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 52 |
miR-5703 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5703 | miRNA Mature ID | miR-5703 | ||
miRNA Sequence |
AGGAGAAGUCGGGAAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 53 |
miR-577 directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-577 | miRNA Mature ID | miR-577 | ||
miRNA Sequence |
UAGAUAAAAUAUUGGUACCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 54 |
miR-580 directly targets SLC25A36 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-580 | miRNA Mature ID | miR-580-3p | ||
miRNA Sequence |
UUGAGAAUGAUGAAUCAUUAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 55 |
miR-636 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-636 | miRNA Mature ID | miR-636 | ||
miRNA Sequence |
UGUGCUUGCUCGUCCCGCCCGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 56 |
miR-6500 directly targets SLC25A36 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6500 | miRNA Mature ID | miR-6500-3p | ||
miRNA Sequence |
ACACUUGUUGGGAUGACCUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 57 |
miR-6733 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6733 | miRNA Mature ID | miR-6733-5p | ||
miRNA Sequence |
UGGGAAAGACAAACUCAGAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 58 |
miR-6733 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6733 | miRNA Mature ID | miR-6733-3p | ||
miRNA Sequence |
UCAGUGUCUGGAUUUCCUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 59 |
miR-6739 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6739 | miRNA Mature ID | miR-6739-5p | ||
miRNA Sequence |
UGGGAAAGAGAAAGAACAAGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 60 |
miR-6750 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6750 | miRNA Mature ID | miR-6750-5p | ||
miRNA Sequence |
CAGGGAACAGCUGGGUGAGCUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 61 |
miR-6768 directly targets SLC25A36 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6768 | miRNA Mature ID | miR-6768-3p | ||
miRNA Sequence |
CAAAGGCCACAUUCUCCUGUGCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 62 |
miR-6822 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6822 | miRNA Mature ID | miR-6822-5p | ||
miRNA Sequence |
CAGGGAACCAGUUGGGGCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 63 |
miR-7855 directly targets SLC25A36 | [ 7 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7855 | miRNA Mature ID | miR-7855-5p | ||
miRNA Sequence |
UUGGUGAGGACCCCAAGCUCGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 64 |
miR-8066 directly targets SLC25A36 | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-8066 | miRNA Mature ID | miR-8066 | ||
miRNA Sequence |
CAAUGUGAUCUUUUGGAUGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 65 |
miR-8082 directly targets SLC25A36 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-8082 | miRNA Mature ID | miR-8082 | ||
miRNA Sequence |
UGAUGGAGCUGGGAAUACUCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 66 |
miR-9 directly targets SLC25A36 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-9 | miRNA Mature ID | miR-9-3p | ||
miRNA Sequence |
AUAAAGCUAGAUAACCGAAAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 67 |
miR-92a directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-92a | miRNA Mature ID | miR-92a-3p | ||
miRNA Sequence |
UAUUGCACUUGUCCCGGCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 68 |
miR-92b directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-92b | miRNA Mature ID | miR-92b-3p | ||
miRNA Sequence |
UAUUGCACUCGUCCCGGCCUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 69 |
miR-9500 directly targets SLC25A36 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-9500 | miRNA Mature ID | miR-9500 | ||
miRNA Sequence |
AAGGGAAGAUGGUGACCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.