Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0199 Transporter Info
Gene Name	SLC25A37
Transporter Name	Mitochondrial iron transporter 1
Gene ID	51312
UniProt ID	Q9NYZ2

Epigenetic Regulations of This DT (EGR)
Methylation
Bladder cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	TSS1500 (cg14755852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 3.10E-04; Z-score: -3.44E+00
Methylation in Case	7.57E-02 (Median)	Methylation in Control	1.14E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	TSS1500 (cg09621438)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.67E+00	Statistic Test	p-value: 7.75E-04; Z-score: -5.35E+00
Methylation in Case	9.24E-02 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	1stExon (cg25944700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.42E-02; Z-score: -1.52E+00
Methylation in Case	3.68E-02 (Median)	Methylation in Control	4.62E-02 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	Body (cg03084648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.11E+00	Statistic Test	p-value: 2.90E-04; Z-score: -4.69E+00
Methylation in Case	6.92E-01 (Median)	Methylation in Control	7.65E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	Body (cg18186478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.42E+00	Statistic Test	p-value: 7.59E-04; Z-score: -3.64E+00
Methylation in Case	5.24E-01 (Median)	Methylation in Control	7.42E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	Body (cg24917065)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 4.98E-03; Z-score: 2.72E+00
Methylation in Case	5.61E-01 (Median)	Methylation in Control	4.65E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	Body (cg02190353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.61E+00	Statistic Test	p-value: 1.49E-02; Z-score: -2.62E+00
Methylation in Case	2.72E-01 (Median)	Methylation in Control	4.38E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	Body (cg00892891)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 2.38E-02; Z-score: -1.66E+00
Methylation in Case	8.08E-01 (Median)	Methylation in Control	8.46E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	Body (cg16812174)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.12E+00	Statistic Test	p-value: 2.46E-02; Z-score: -2.14E+00
Methylation in Case	7.01E-01 (Median)	Methylation in Control	7.87E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A37 in bladder cancer			[ 1 ]
Location	Body (cg18065686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 3.64E-02; Z-score: 1.02E+00
Methylation in Case	9.00E-01 (Median)	Methylation in Control	8.60E-01 (Median)
Studied Phenotype	Bladder cancer [ ICD-11: 2C94]
Experimental Material	Patient tissue samples
Breast cancer	10 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	TSS1500 (cg01770362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.35E+00	Statistic Test	p-value: 6.33E-23; Z-score: 3.48E+00
Methylation in Case	6.15E-01 (Median)	Methylation in Control	4.56E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	TSS1500 (cg11051899)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.07E+00	Statistic Test	p-value: 2.94E-07; Z-score: 1.09E+00
Methylation in Case	8.29E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	TSS1500 (cg09621438)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.20E+00	Statistic Test	p-value: 7.04E-05; Z-score: 6.61E-01
Methylation in Case	1.18E-01 (Median)	Methylation in Control	9.85E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	TSS1500 (cg14755852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 8.17E-05; Z-score: 1.20E+00
Methylation in Case	1.24E-01 (Median)	Methylation in Control	1.06E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	Body (cg07659624)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.13E+00	Statistic Test	p-value: 7.18E-07; Z-score: 1.59E+00
Methylation in Case	7.03E-01 (Median)	Methylation in Control	6.20E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	Body (cg02190353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.30E+00	Statistic Test	p-value: 1.18E-06; Z-score: 1.14E+00
Methylation in Case	5.25E-01 (Median)	Methylation in Control	4.04E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	Body (cg03084648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 1.84E-04; Z-score: -1.23E+00
Methylation in Case	7.36E-01 (Median)	Methylation in Control	7.86E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	Body (cg00669044)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.14E-03; Z-score: -1.19E+00
Methylation in Case	8.90E-01 (Median)	Methylation in Control	9.28E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	Body (cg16812174)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.09E+00	Statistic Test	p-value: 3.98E-03; Z-score: 1.08E+00
Methylation in Case	8.28E-01 (Median)	Methylation in Control	7.59E-01 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A37 in breast cancer			[ 2 ]
Location	Body (cg20890157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 4.41E-02; Z-score: 6.39E-01
Methylation in Case	6.50E-02 (Median)	Methylation in Control	5.27E-02 (Median)
Studied Phenotype	Breast cancer [ ICD-11: 2C60-2C6Z]
Experimental Material	Patient tissue samples
Renal cell carcinoma	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS1500 (cg01770362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.25E+00	Statistic Test	p-value: 1.17E-08; Z-score: 2.26E+00
Methylation in Case	6.59E-01 (Median)	Methylation in Control	5.29E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in clear cell renal cell carcinoma			[ 3 ]
Location	TSS200 (cg17522466)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 2.03E-02; Z-score: 5.06E-01
Methylation in Case	1.88E-02 (Median)	Methylation in Control	1.74E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in clear cell renal cell carcinoma			[ 3 ]
Location	1stExon (cg25944700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 8.82E-03; Z-score: 6.07E-01
Methylation in Case	1.17E-02 (Median)	Methylation in Control	1.04E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg20890157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 1.73E-03; Z-score: 8.66E-01
Methylation in Case	3.77E-02 (Median)	Methylation in Control	2.97E-02 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A37 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg03084648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 7.87E-03; Z-score: -1.14E+00
Methylation in Case	8.80E-01 (Median)	Methylation in Control	8.99E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A37 in clear cell renal cell carcinoma			[ 3 ]
Location	Body (cg20207276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 1.54E-02; Z-score: 2.51E+00
Methylation in Case	8.98E-01 (Median)	Methylation in Control	7.85E-01 (Median)
Studied Phenotype	Renal cell carcinoma [ ICD-11: 2C90]
Experimental Material	Patient tissue samples
Colorectal cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg09621438)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.26E+00	Statistic Test	p-value: 1.79E-07; Z-score: -1.71E+00
Methylation in Case	2.08E-01 (Median)	Methylation in Control	2.61E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in colorectal cancer			[ 4 ]
Location	TSS1500 (cg11051899)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.86E-02; Z-score: -4.81E-01
Methylation in Case	8.97E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in colorectal cancer			[ 4 ]
Location	1stExon (cg20763254)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.44E-02; Z-score: 2.60E-01
Methylation in Case	9.60E-03 (Median)	Methylation in Control	8.59E-03 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in colorectal cancer			[ 4 ]
Location	1stExon (cg25944700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 4.11E-02; Z-score: 7.34E-01
Methylation in Case	5.84E-02 (Median)	Methylation in Control	5.03E-02 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A37 in colorectal cancer			[ 4 ]
Location	Body (cg03084648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 2.30E-05; Z-score: -1.35E+00
Methylation in Case	8.55E-01 (Median)	Methylation in Control	8.79E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A37 in colorectal cancer			[ 4 ]
Location	Body (cg07659624)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.03E+00	Statistic Test	p-value: 7.09E-05; Z-score: -1.01E+00
Methylation in Case	9.04E-01 (Median)	Methylation in Control	9.32E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A37 in colorectal cancer			[ 4 ]
Location	Body (cg26801445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 4.06E-04; Z-score: -1.14E+00
Methylation in Case	9.12E-01 (Median)	Methylation in Control	9.27E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A37 in colorectal cancer			[ 4 ]
Location	Body (cg20207276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.21E+00	Statistic Test	p-value: 1.49E-03; Z-score: 1.40E+00
Methylation in Case	8.67E-01 (Median)	Methylation in Control	7.17E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A37 in colorectal cancer			[ 4 ]
Location	Body (cg02190353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.20E+00	Statistic Test	p-value: 4.49E-03; Z-score: -7.51E-01
Methylation in Case	4.57E-01 (Median)	Methylation in Control	5.51E-01 (Median)
Studied Phenotype	Colorectal cancer [ ICD-11: 2B91]
Experimental Material	Patient tissue samples
Hepatocellular carcinoma	13 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg11051899)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.03E+00	Statistic Test	p-value: 5.06E-05; Z-score: 7.78E-01
Methylation in Case	8.37E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg14755852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.14E+00	Statistic Test	p-value: 5.25E-03; Z-score: -7.01E-01
Methylation in Case	1.35E-01 (Median)	Methylation in Control	1.54E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	TSS1500 (cg01770362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.95E-02; Z-score: 8.07E-01
Methylation in Case	6.72E-01 (Median)	Methylation in Control	6.34E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg04927695)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.53E+00	Statistic Test	p-value: 6.76E-19; Z-score: -6.26E+00
Methylation in Case	4.43E-01 (Median)	Methylation in Control	6.77E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg06972578)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.51E+00	Statistic Test	p-value: 1.09E-12; Z-score: -4.50E+00
Methylation in Case	4.35E-01 (Median)	Methylation in Control	6.58E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg15704872)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.77E+00	Statistic Test	p-value: 7.75E-11; Z-score: -2.23E+00
Methylation in Case	2.00E-01 (Median)	Methylation in Control	3.53E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg03084648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 5.97E-05; Z-score: -9.61E-01
Methylation in Case	7.49E-01 (Median)	Methylation in Control	7.78E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg20207276)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.08E+00	Statistic Test	p-value: 8.47E-04; Z-score: 1.05E+00
Methylation in Case	7.86E-01 (Median)	Methylation in Control	7.26E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg00892891)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.02E+00	Statistic Test	p-value: 1.10E-03; Z-score: -6.03E-01
Methylation in Case	8.73E-01 (Median)	Methylation in Control	8.88E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg02190353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.08E+00	Statistic Test	p-value: 1.19E-03; Z-score: -7.49E-01
Methylation in Case	6.67E-01 (Median)	Methylation in Control	7.19E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg07659624)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 1.42E-02; Z-score: 9.38E-01
Methylation in Case	7.98E-01 (Median)	Methylation in Control	7.67E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg16812174)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 1.77E-02; Z-score: -3.52E-01
Methylation in Case	8.91E-01 (Median)	Methylation in Control	8.97E-01 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	Methylation of SLC25A37 in hepatocellular carcinoma			[ 5 ]
Location	Body (cg20890157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 4.57E-02; Z-score: 2.79E-01
Methylation in Case	8.84E-02 (Median)	Methylation in Control	8.04E-02 (Median)
Studied Phenotype	Hepatocellular carcinoma [ ICD-11: 2C12.02]
Experimental Material	Patient tissue samples
Lung adenocarcinoma	5 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in lung adenocarcinoma			[ 6 ]
Location	TSS1500 (cg01770362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.12E+00	Statistic Test	p-value: 2.15E-02; Z-score: 1.18E+00
Methylation in Case	6.34E-01 (Median)	Methylation in Control	5.66E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in lung adenocarcinoma			[ 6 ]
Location	1stExon (cg25944700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.10E+00	Statistic Test	p-value: 3.64E-02; Z-score: 1.29E+00
Methylation in Case	6.02E-02 (Median)	Methylation in Control	5.50E-02 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in lung adenocarcinoma			[ 6 ]
Location	Body (cg02190353)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.74E+00	Statistic Test	p-value: 5.53E-04; Z-score: 5.26E+00
Methylation in Case	6.15E-01 (Median)	Methylation in Control	3.53E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in lung adenocarcinoma			[ 6 ]
Location	Body (cg18065686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.05E+00	Statistic Test	p-value: 8.41E-04; Z-score: 1.57E+00
Methylation in Case	8.56E-01 (Median)	Methylation in Control	8.12E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A37 in lung adenocarcinoma			[ 6 ]
Location	Body (cg03084648)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.05E+00	Statistic Test	p-value: 3.11E-03; Z-score: -1.96E+00
Methylation in Case	7.93E-01 (Median)	Methylation in Control	8.34E-01 (Median)
Studied Phenotype	Lung adenocarcinoma [ ICD-11: 2C25.0]
Experimental Material	Patient tissue samples
Pancretic ductal adenocarcinoma	11 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg06375292)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.19E+00	Statistic Test	p-value: 5.74E-18; Z-score: -2.47E+00
Methylation in Case	5.52E-01 (Median)	Methylation in Control	6.58E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg04344565)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 2.74E+00	Statistic Test	p-value: 1.59E-13; Z-score: 2.88E+00
Methylation in Case	4.39E-01 (Median)	Methylation in Control	1.60E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg02322908)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.91E+00	Statistic Test	p-value: 2.31E-06; Z-score: -1.61E+00
Methylation in Case	1.59E-01 (Median)	Methylation in Control	3.04E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg18250838)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.19E+00	Statistic Test	p-value: 2.16E-04; Z-score: 5.66E-01
Methylation in Case	2.21E-01 (Median)	Methylation in Control	1.85E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS1500 (cg19215261)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 2.11E-02; Z-score: 4.01E-01
Methylation in Case	9.17E-01 (Median)	Methylation in Control	9.12E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS200 (cg17298269)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.52E+00	Statistic Test	p-value: 1.83E-14; Z-score: -2.57E+00
Methylation in Case	1.80E-01 (Median)	Methylation in Control	2.73E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	TSS200 (cg22988581)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.16E+00	Statistic Test	p-value: 3.90E-02; Z-score: 6.73E-01
Methylation in Case	4.53E-01 (Median)	Methylation in Control	3.92E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg24856673)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.27E+00	Statistic Test	p-value: 3.56E-07; Z-score: 1.47E+00
Methylation in Case	4.53E-01 (Median)	Methylation in Control	3.57E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	Body (cg15930240)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 4.85E-07; Z-score: -1.07E+00
Methylation in Case	7.10E-01 (Median)	Methylation in Control	7.50E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 10	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	3'UTR (cg09292202)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.14E+00	Statistic Test	p-value: 6.79E-04; Z-score: 9.24E-01
Methylation in Case	7.50E-01 (Median)	Methylation in Control	6.57E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	Methylation of SLC25A37 in pancretic ductal adenocarcinoma			[ 7 ]
Location	3'UTR (cg05627826)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.04E+00	Statistic Test	p-value: 4.44E-02; Z-score: 6.75E-01
Methylation in Case	7.87E-01 (Median)	Methylation in Control	7.60E-01 (Median)
Studied Phenotype	Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]
Experimental Material	Patient tissue samples
Panic disorder	4 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in panic disorder			[ 8 ]
Location	TSS1500 (cg11051899)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.50E-02; Z-score: 4.84E-01
Methylation in Case	3.34E+00 (Median)	Methylation in Control	3.16E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in panic disorder			[ 8 ]
Location	1stExon (cg25944700)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 9.81E-01	Statistic Test	p-value: 3.14E-04; Z-score: 4.12E-01
Methylation in Case	-5.60E+00 (Median)	Methylation in Control	-5.70E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in panic disorder			[ 8 ]
Location	Body (cg00669044)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 2.02E-02; Z-score: 3.85E-01
Methylation in Case	2.39E+00 (Median)	Methylation in Control	2.25E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in panic disorder			[ 8 ]
Location	Body (cg26801445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 4.74E-02; Z-score: 3.07E-01
Methylation in Case	3.23E+00 (Median)	Methylation in Control	3.16E+00 (Median)
Studied Phenotype	Panic disorder [ ICD-11: 6B01]
Experimental Material	Patient tissue samples
Papillary thyroid cancer	9 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg01770362)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.17E+00	Statistic Test	p-value: 2.79E-04; Z-score: 1.23E+00
Methylation in Case	5.27E-01 (Median)	Methylation in Control	4.49E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg11051899)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.11E+00	Statistic Test	p-value: 5.63E-04; Z-score: 2.08E+00
Methylation in Case	8.92E-01 (Median)	Methylation in Control	8.05E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg14755852)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.34E+00	Statistic Test	p-value: 7.12E-04; Z-score: -1.35E+00
Methylation in Case	1.04E-01 (Median)	Methylation in Control	1.39E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in papillary thyroid cancer			[ 9 ]
Location	TSS1500 (cg09621438)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.44E+00	Statistic Test	p-value: 1.30E-02; Z-score: -1.05E+00
Methylation in Case	1.16E-01 (Median)	Methylation in Control	1.68E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A37 in papillary thyroid cancer			[ 9 ]
Location	Body (cg20890157)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.21E+00	Statistic Test	p-value: 1.25E-05; Z-score: -9.51E-01
Methylation in Case	7.57E-02 (Median)	Methylation in Control	9.17E-02 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A37 in papillary thyroid cancer			[ 9 ]
Location	Body (cg16812174)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.02E+00	Statistic Test	p-value: 5.90E-04; Z-score: 9.04E-01
Methylation in Case	9.39E-01 (Median)	Methylation in Control	9.17E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 7	Methylation of SLC25A37 in papillary thyroid cancer			[ 9 ]
Location	Body (cg18186478)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.06E+00	Statistic Test	p-value: 1.11E-03; Z-score: 8.91E-01
Methylation in Case	8.23E-01 (Median)	Methylation in Control	7.80E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 8	Methylation of SLC25A37 in papillary thyroid cancer			[ 9 ]
Location	Body (cg18065686)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.01E+00	Statistic Test	p-value: 1.76E-03; Z-score: 9.85E-01
Methylation in Case	9.34E-01 (Median)	Methylation in Control	9.21E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 9	Methylation of SLC25A37 in papillary thyroid cancer			[ 9 ]
Location	Body (cg26801445)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.01E+00	Statistic Test	p-value: 2.21E-03; Z-score: -1.95E-01
Methylation in Case	8.36E-01 (Median)	Methylation in Control	8.44E-01 (Median)
Studied Phenotype	Papillary thyroid cancer [ ICD-11: 2D10.1]
Experimental Material	Patient tissue samples
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in prostate cancer			[ 10 ]
Location	TSS1500 (cg02701825)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 3.47E+00	Statistic Test	p-value: 2.85E-03; Z-score: 2.21E+01
Methylation in Case	5.62E-01 (Median)	Methylation in Control	1.62E-01 (Median)
Studied Phenotype	Prostate cancer [ ICD-11: 2C82]
Experimental Material	Patient tissue samples
Colon cancer	6 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Methylation of SLC25A37 in colon adenocarcinoma			[ 11 ]
Location	TSS200 (cg16600501)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.06E+00	Statistic Test	p-value: 1.31E-03; Z-score: -2.37E+00
Methylation in Case	8.70E-01 (Median)	Methylation in Control	9.18E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 2	Methylation of SLC25A37 in colon adenocarcinoma			[ 11 ]
Location	Body (cg14381448)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.25E+00	Statistic Test	p-value: 1.99E-07; Z-score: -2.73E+00
Methylation in Case	5.55E-01 (Median)	Methylation in Control	6.96E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 3	Methylation of SLC25A37 in colon adenocarcinoma			[ 11 ]
Location	Body (cg09660365)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.15E+00	Statistic Test	p-value: 3.10E-04; Z-score: 1.02E+00
Methylation in Case	5.38E-01 (Median)	Methylation in Control	4.68E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 4	Methylation of SLC25A37 in colon adenocarcinoma			[ 11 ]
Location	Body (cg00967552)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: 1.23E+00	Statistic Test	p-value: 1.20E-03; Z-score: 1.62E+00
Methylation in Case	3.28E-01 (Median)	Methylation in Control	2.66E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 5	Methylation of SLC25A37 in colon adenocarcinoma			[ 11 ]
Location	Body (cg15266604)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.04E+00	Statistic Test	p-value: 2.27E-03; Z-score: -1.74E+00
Methylation in Case	8.17E-01 (Median)	Methylation in Control	8.48E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 6	Methylation of SLC25A37 in colon adenocarcinoma			[ 11 ]
Location	3'UTR (cg18150383)
Epigenetic Type	Methylation	Experiment Method	Infinium HumanMethylation450 BeadChip
Methylation Fold Change	Fold Change: -1.07E+00	Statistic Test	p-value: 2.99E-03; Z-score: -2.24E+00
Methylation in Case	7.63E-01 (Median)	Methylation in Control	8.15E-01 (Median)
Studied Phenotype	Colon cancer [ ICD-11: 2B90]
Experimental Material	Patient tissue samples
microRNA
Unclear Phenotype	55 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-150 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-150	miRNA Mature ID	miR-150-5p
miRNA Sequence	UCUCCCAACCCUUGUACCAGUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-17 directly targets SLC25A37			[ 13 ]
Epigenetic Type	microRNA	Experiment Method	CLASH
miRNA Stemloop ID	miR-17	miRNA Mature ID	miR-17-5p
miRNA Sequence	CAAAGUGCUUACAGUGCAGGUAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 3	miR-181a directly targets SLC25A37			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-181a	miRNA Mature ID	miR-181a-5p
miRNA Sequence	AACAUUCAACGCUGUCGGUGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-181b directly targets SLC25A37			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-181b	miRNA Mature ID	miR-181b-5p
miRNA Sequence	AACAUUCAUUGCUGUCGGUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-181c directly targets SLC25A37			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-181c	miRNA Mature ID	miR-181c-5p
miRNA Sequence	AACAUUCAACCUGUCGGUGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-181d directly targets SLC25A37			[ 14 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-181d	miRNA Mature ID	miR-181d-5p
miRNA Sequence	AACAUUCAUUGUUGUCGGUGGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-18a directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-18a	miRNA Mature ID	miR-18a-5p
miRNA Sequence	UAAGGUGCAUCUAGUGCAGAUAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 8	miR-18b directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-18b	miRNA Mature ID	miR-18b-5p
miRNA Sequence	UAAGGUGCAUCUAGUGCAGUUAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 9	miR-1976 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-1976	miRNA Mature ID	miR-1976
miRNA Sequence	CCUCCUGCCCUCCUUGCUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-2681 directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-2681	miRNA Mature ID	miR-2681-5p
miRNA Sequence	GUUUUACCACCUCCAGGAGACU
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 11	miR-30a directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30a	miRNA Mature ID	miR-30a-3p
miRNA Sequence	CUUUCAGUCGGAUGUUUGCAGC
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 12	miR-30d directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30d	miRNA Mature ID	miR-30d-3p
miRNA Sequence	CUUUCAGUCAGAUGUUUGCUGC
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 13	miR-30e directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-30e	miRNA Mature ID	miR-30e-3p
miRNA Sequence	CUUUCAGUCGGAUGUUUACAGC
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 14	miR-3144 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3144	miRNA Mature ID	miR-3144-5p
miRNA Sequence	AGGGGACCAAAGAGAUAUAUAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 15	miR-3191 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3191	miRNA Mature ID	miR-3191-3p
miRNA Sequence	UGGGGACGUAGCUGGCCAGACAG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 16	miR-3606 directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3606	miRNA Mature ID	miR-3606-3p
miRNA Sequence	AAAAUUUCUUUCACUACUUAG
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 17	miR-3617 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3617	miRNA Mature ID	miR-3617-5p
miRNA Sequence	AAAGACAUAGUUGCAAGAUGGG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 18	miR-365a directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-365a	miRNA Mature ID	miR-365a-5p
miRNA Sequence	AGGGACUUUUGGGGGCAGAUGUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 19	miR-365b directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-365b	miRNA Mature ID	miR-365b-5p
miRNA Sequence	AGGGACUUUCAGGGGCAGCUGU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 20	miR-4279 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4279	miRNA Mature ID	miR-4279
miRNA Sequence	CUCUCCUCCCGGCUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-4443 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4443	miRNA Mature ID	miR-4443
miRNA Sequence	UUGGAGGCGUGGGUUUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 22	miR-4476 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4476	miRNA Mature ID	miR-4476
miRNA Sequence	CAGGAAGGAUUUAGGGACAGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 23	miR-452 directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-452	miRNA Mature ID	miR-452-5p
miRNA Sequence	AACUGUUUGCAGAGGAAACUGA
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 24	miR-4652 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4652	miRNA Mature ID	miR-4652-5p
miRNA Sequence	AGGGGACUGGUUAAUAGAACUA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 25	miR-4676 directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4676	miRNA Mature ID	miR-4676-3p
miRNA Sequence	CACUGUUUCACCACUGGCUCUU
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 26	miR-4693 directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4693	miRNA Mature ID	miR-4693-5p
miRNA Sequence	AUACUGUGAAUUUCACUGUCACA
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 27	miR-4704 directly targets SLC25A37			[ 17 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4704	miRNA Mature ID	miR-4704-3p
miRNA Sequence	UCAGUCACAUAUCUAGUGUCUA
miRNA Target Type	Direct
Experimental Material	Left ventricular cardiac tissues of human
Epigenetic Phenomenon 28	miR-4722 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4722	miRNA Mature ID	miR-4722-3p
miRNA Sequence	ACCUGCCAGCACCUCCCUGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-4735 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4735	miRNA Mature ID	miR-4735-3p
miRNA Sequence	AAAGGUGCUCAAAUUAGACAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 30	miR-5089 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5089	miRNA Mature ID	miR-5089-5p
miRNA Sequence	GUGGGAUUUCUGAGUAGCAUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-513a directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-513a	miRNA Mature ID	miR-513a-3p
miRNA Sequence	UAAAUUUCACCUUUCUGAGAAGG
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 32	miR-513c directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-513c	miRNA Mature ID	miR-513c-3p
miRNA Sequence	UAAAUUUCACCUUUCUGAGAAGA
miRNA Target Type	Direct
Experimental Material	Patient tissue samples
Epigenetic Phenomenon 33	miR-552 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-552	miRNA Mature ID	miR-552-3p
miRNA Sequence	AACAGGUGACUGGUUAGACAA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-5571 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-5571	miRNA Mature ID	miR-5571-5p
miRNA Sequence	CAAUUCUCAAAGGAGCCUCCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-582 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-582	miRNA Mature ID	miR-582-3p
miRNA Sequence	UAACUGGUUGAACAACUGAACC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-619 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-619	miRNA Mature ID	miR-619-5p
miRNA Sequence	GCUGGGAUUACAGGCAUGAGCC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-636 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-636	miRNA Mature ID	miR-636
miRNA Sequence	UGUGCUUGCUCGUCCCGCCCGCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 38	miR-641 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-641	miRNA Mature ID	miR-641
miRNA Sequence	AAAGACAUAGGAUAGAGUCACCUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 39	miR-6504 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6504	miRNA Mature ID	miR-6504-3p
miRNA Sequence	CAUUACAGCACAGCCAUUCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 40	miR-6505 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6505	miRNA Mature ID	miR-6505-5p
miRNA Sequence	UUGGAAUAGGGGAUAUCUCAGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 41	miR-6506 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6506	miRNA Mature ID	miR-6506-5p
miRNA Sequence	ACUGGGAUGUCACUGAAUAUGGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 42	miR-6515 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6515	miRNA Mature ID	miR-6515-5p
miRNA Sequence	UUGGAGGGUGUGGAAGACAUC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 43	miR-6727 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6727	miRNA Mature ID	miR-6727-3p
miRNA Sequence	UCCUGCCACCUCCUCCGCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 44	miR-6747 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6747	miRNA Mature ID	miR-6747-3p
miRNA Sequence	UCCUGCCUUCCUCUGCACCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 45	miR-6778 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6778	miRNA Mature ID	miR-6778-3p
miRNA Sequence	UGCCUCCCUGACAUUCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 46	miR-6810 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6810	miRNA Mature ID	miR-6810-5p
miRNA Sequence	AUGGGGACAGGGAUCAGCAUGGC
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 47	miR-6814 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6814	miRNA Mature ID	miR-6814-5p
miRNA Sequence	UCCCAAGGGUGAGAUGCUGCCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 48	miR-6876 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6876	miRNA Mature ID	miR-6876-5p
miRNA Sequence	CAGGAAGGAGACAGGCAGUUCA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 49	miR-6894 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6894	miRNA Mature ID	miR-6894-5p
miRNA Sequence	AGGAGGAUGGAGAGCUGGGCCAGA
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 50	miR-7 directly targets SLC25A37			[ 18 ]
Epigenetic Type	microRNA	Experiment Method	Sequencing
miRNA Stemloop ID	miR-7	miRNA Mature ID	miR-7-5p
miRNA Sequence	UGGAAGACUAGUGAUUUUGUUGUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 51	miR-7151 directly targets SLC25A37			[ 12 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-7151	miRNA Mature ID	miR-7151-3p
miRNA Sequence	CUACAGGCUGGAAUGGGCUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 52	miR-7154 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7154	miRNA Mature ID	miR-7154-3p
miRNA Sequence	AGGAGGACAAGUUGUGGGAU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 53	miR-765 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-765	miRNA Mature ID	miR-765
miRNA Sequence	UGGAGGAGAAGGAAGGUGAUG
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 54	miR-766 directly targets SLC25A37			[ 15 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-766	miRNA Mature ID	miR-766-5p
miRNA Sequence	AGGAGGAAUUGGUGCUGGUCUU
miRNA Target Type	Direct
Experimental Material	Human embryonic kidney 293 cells (HEK293)
Epigenetic Phenomenon 55	miR-892c directly targets SLC25A37			[ 16 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-892c	miRNA Mature ID	miR-892c-3p
miRNA Sequence	CACUGUUUCCUUUCUGAGUGGA
miRNA Target Type	Direct
Experimental Material	Patient tissue samples

References
1	DNA Methylation Dynamics in Urological Tumors.
2	Genome-wide Scan for Methylation Profiles in Breast Cancer
3	A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
4	Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
5	Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
6	DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
7	Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
8	DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
9	Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10	Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
11	Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
12	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
13	Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
14	EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
15	Circular RNAs are a large class of animal RNAs with regulatory potency. Nature. 2013 Mar 21;495(7441):333-8.
16	Argonaute CLIP Defines a Deregulated miR-122-Bound Transcriptome that Correlates with Patient Survival in Human Liver Cancer. Mol Cell. 2017 Aug 3;67(3):400-410.e7.
17	Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
18	Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence