Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0222 Transporter Info | ||||
Gene Name | SLC25A6 | ||||
Transporter Name | Adenine nucleotide translocator 3 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
20 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-139 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-139 | miRNA Mature ID | miR-139-5p | ||
miRNA Sequence |
UCUACAGUGCACGUGUCUCCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 2 |
miR-16 directly targets SLC25A6 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 3 |
miR-204 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-204 | miRNA Mature ID | miR-204-3p | ||
miRNA Sequence |
GCUGGGAAGGCAAAGGGACGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-3148 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3148 | miRNA Mature ID | miR-3148 | ||
miRNA Sequence |
UGGAAAAAACUGGUGUGUGCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-3153 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3153 | miRNA Mature ID | miR-3153 | ||
miRNA Sequence |
GGGGAAAGCGAGUAGGGACAUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-421 directly targets SLC25A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-421 | miRNA Mature ID | miR-421 | ||
miRNA Sequence |
AUCAACAGACAUUAAUUGGGCGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 7 |
miR-423 directly targets SLC25A6 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
miR-423 | miRNA Mature ID | miR-423-3p | ||
miRNA Sequence |
AGCUCGGUCUGAGGCCCCUCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 8 |
miR-4438 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4438 | miRNA Mature ID | miR-4438 | ||
miRNA Sequence |
CACAGGCUUAGAAAAGACAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-4505 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4505 | miRNA Mature ID | miR-4505 | ||
miRNA Sequence |
AGGCUGGGCUGGGACGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-4514 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4514 | miRNA Mature ID | miR-4514 | ||
miRNA Sequence |
ACAGGCAGGAUUGGGGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-4646 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4646 | miRNA Mature ID | miR-4646-5p | ||
miRNA Sequence |
ACUGGGAAGAGGAGCUGAGGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 12 |
miR-4668 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4668 | miRNA Mature ID | miR-4668-5p | ||
miRNA Sequence |
AGGGAAAAAAAAAAGGAUUUGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-4692 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4692 | miRNA Mature ID | miR-4692 | ||
miRNA Sequence |
UCAGGCAGUGUGGGUAUCAGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-5787 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5787 | miRNA Mature ID | miR-5787 | ||
miRNA Sequence |
GGGCUGGGGCGCGGGGAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-6733 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6733 | miRNA Mature ID | miR-6733-5p | ||
miRNA Sequence |
UGGGAAAGACAAACUCAGAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-6739 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6739 | miRNA Mature ID | miR-6739-5p | ||
miRNA Sequence |
UGGGAAAGAGAAAGAACAAGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-6808 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6808 | miRNA Mature ID | miR-6808-5p | ||
miRNA Sequence |
CAGGCAGGGAGGUGGGACCAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-6893 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6893 | miRNA Mature ID | miR-6893-5p | ||
miRNA Sequence |
CAGGCAGGUGUAGGGUGGAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 19 |
miR-7151 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7151 | miRNA Mature ID | miR-7151-3p | ||
miRNA Sequence |
CUACAGGCUGGAAUGGGCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 20 |
miR-940 directly targets SLC25A6 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-940 | miRNA Mature ID | miR-940 | ||
miRNA Sequence |
AAGGCAGGGCCCCCGCUCCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.