Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0230 Transporter Info
Gene Name SLC26A2
Transporter Name Sulfate transporter
Gene ID
1836
UniProt ID
P50443
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg00394021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.46E+00 Statistic Test p-value: 4.96E-09; Z-score: -1.29E+00

Methylation in Case

 4.34E-01 (Median) Methylation in Control 6.34E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg02700824)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.33E+00 Statistic Test p-value: 1.35E-08; Z-score: 1.76E+00

Methylation in Case

 8.26E-01 (Median) Methylation in Control 6.22E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg25054311)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 8.96E-06; Z-score: -1.13E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg26303603)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 1.19E-05; Z-score: 6.54E-01

Methylation in Case

 8.62E-01 (Median) Methylation in Control 7.35E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg26668000)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.23E-05; Z-score: -9.07E-01

Methylation in Case

 7.38E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC26A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg24857795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.55E+00 Statistic Test p-value: 1.76E-09; Z-score: -1.48E+00

Methylation in Case

 4.56E-01 (Median) Methylation in Control 7.07E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in bladder cancer [ 2 ]

Location

 5'UTR (cg26668000)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.14E-07; Z-score: -6.57E+00

Methylation in Case

 6.87E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in bladder cancer [ 2 ]

Location

 5'UTR (cg25054311)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 4.69E-04; Z-score: -2.83E+00

Methylation in Case

 5.80E-02 (Median) Methylation in Control 8.83E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in bladder cancer [ 2 ]

Location

 5'UTR (cg26303603)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 7.20E-04; Z-score: -2.60E+00

Methylation in Case

 8.12E-01 (Median) Methylation in Control 8.58E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A2 in bladder cancer [ 2 ]

Location

 5'UTR (cg00394021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.39E+00 Statistic Test p-value: 9.51E-04; Z-score: -2.58E+00

Methylation in Case

 8.67E-02 (Median) Methylation in Control 1.20E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A2 in bladder cancer [ 2 ]

Location

 TSS200 (cg04088893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.29E+00 Statistic Test p-value: 2.15E-03; Z-score: -2.97E+00

Methylation in Case

 6.13E-02 (Median) Methylation in Control 7.89E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC26A2 in bladder cancer [ 2 ]

Location

 Body (cg19447692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 4.68E-02; Z-score: -1.54E+00

Methylation in Case

 9.19E-01 (Median) Methylation in Control 9.27E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

          10 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 5'UTR (cg00394021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.41E+00 Statistic Test p-value: 3.69E-08; Z-score: 1.95E+00

Methylation in Case

 1.84E-01 (Median) Methylation in Control 1.30E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 5'UTR (cg26668000)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 9.72E-03; Z-score: -7.52E-01

Methylation in Case

 8.08E-01 (Median) Methylation in Control 8.43E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 5'UTR (cg25054311)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.24E-02; Z-score: 8.86E-02

Methylation in Case

 9.09E-02 (Median) Methylation in Control 8.86E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 5'UTR (cg02700824)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.26E+00 Statistic Test p-value: 2.21E-02; Z-score: 1.05E-01

Methylation in Case

 6.71E-03 (Median) Methylation in Control 5.33E-03 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 TSS1500 (cg02319142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 1.59E-03; Z-score: 2.68E-01

Methylation in Case

 9.84E-02 (Median) Methylation in Control 8.95E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 TSS1500 (cg12661370)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.36E+00 Statistic Test p-value: 4.67E-02; Z-score: 4.21E-01

Methylation in Case

 1.63E-02 (Median) Methylation in Control 1.20E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 TSS200 (cg19644351)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 4.80E-03; Z-score: -4.27E-01

Methylation in Case

 5.01E-02 (Median) Methylation in Control 5.84E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 TSS200 (cg20540378)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.13E+00 Statistic Test p-value: 3.71E-02; Z-score: -4.60E-01

Methylation in Case

 5.48E-02 (Median) Methylation in Control 6.19E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 Body (cg19447692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 4.34E-02; Z-score: -4.82E-01

Methylation in Case

 8.98E-01 (Median) Methylation in Control 9.12E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC26A2 in breast cancer [ 3 ]

Location

 3'UTR (cg24857795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.40E-02; Z-score: -4.56E-01

Methylation in Case

 8.79E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg00394021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 5.13E-04; Z-score: 5.52E-01

Methylation in Case

 9.42E-02 (Median) Methylation in Control 7.59E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in clear cell renal cell carcinoma [ 4 ]

Location

 5'UTR (cg25054311)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 7.79E-03; Z-score: 7.25E-01

Methylation in Case

 4.81E-02 (Median) Methylation in Control 3.96E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg02319142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.16E+00 Statistic Test p-value: 3.11E-03; Z-score: 6.68E-01

Methylation in Case

 3.62E-02 (Median) Methylation in Control 3.13E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A2 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg20540378)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 1.33E-02; Z-score: 4.87E-01

Methylation in Case

 2.01E-02 (Median) Methylation in Control 1.84E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A2 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg19644351)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 2.09E-02; Z-score: 2.33E-01

Methylation in Case

 1.94E-02 (Median) Methylation in Control 1.88E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in colorectal cancer [ 5 ]

Location

 5'UTR (cg26303603)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 1.34E-04; Z-score: 1.03E+00

Methylation in Case

 9.07E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg02319142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.63E+00 Statistic Test p-value: 2.44E-06; Z-score: -1.66E+00

Methylation in Case

 1.33E-01 (Median) Methylation in Control 2.17E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in colorectal cancer [ 5 ]

Location

 TSS200 (cg22640213)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 1.73E-02; Z-score: 8.60E-01

Methylation in Case

 7.19E-02 (Median) Methylation in Control 6.47E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A2 in colorectal cancer [ 5 ]

Location

 TSS200 (cg26354587)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 3.72E-02; Z-score: 5.53E-01

Methylation in Case

 1.23E-02 (Median) Methylation in Control 1.05E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A2 in colorectal cancer [ 5 ]

Location

 Body (cg19447692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.11E-02; Z-score: 4.44E-01

Methylation in Case

 9.50E-01 (Median) Methylation in Control 9.43E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg08701604)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 1.04E-12; Z-score: -4.38E+00

Methylation in Case

 6.71E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg02700824)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 8.74E-04; Z-score: -1.77E-03

Methylation in Case

 2.69E-02 (Median) Methylation in Control 2.70E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg26668000)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.71E-03; Z-score: -4.71E-01

Methylation in Case

 8.14E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg00394021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 4.94E-03; Z-score: 7.87E-02

Methylation in Case

 2.16E-01 (Median) Methylation in Control 2.13E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 5'UTR (cg25054311)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.47E-02; Z-score: -7.64E-02

Methylation in Case

 1.21E-01 (Median) Methylation in Control 1.23E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg02319142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.38E+00 Statistic Test p-value: 5.25E-07; Z-score: 1.58E+00

Methylation in Case

 1.52E-01 (Median) Methylation in Control 1.10E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg13237906)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.50E-02; Z-score: -1.89E-01

Methylation in Case

 4.78E-02 (Median) Methylation in Control 4.99E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg22335882)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.26E+00 Statistic Test p-value: 1.01E-10; Z-score: -4.08E+00

Methylation in Case

 6.35E-01 (Median) Methylation in Control 8.02E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg04685302)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 6.26E-10; Z-score: -4.55E+00

Methylation in Case

 6.94E-01 (Median) Methylation in Control 7.89E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg19447692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 9.53E-05; Z-score: -5.55E-01

Methylation in Case

 8.70E-01 (Median) Methylation in Control 8.84E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC26A2 in hepatocellular carcinoma [ 6 ]

Location

 3'UTR (cg24857795)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.30E-05; Z-score: -5.35E-01

Methylation in Case

 8.48E-01 (Median) Methylation in Control 8.67E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in HIV infection [ 7 ]

Location

 5'UTR (cg00394021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.12E+00 Statistic Test p-value: 3.66E-04; Z-score: 5.19E-01

Methylation in Case

 2.53E-01 (Median) Methylation in Control 2.26E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in HIV infection [ 7 ]

Location

 5'UTR (cg25054311)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 2.22E-03; Z-score: 8.52E-01

Methylation in Case

 1.41E-01 (Median) Methylation in Control 1.19E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in HIV infection [ 7 ]

Location

 TSS1500 (cg02515800)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 3.67E-03; Z-score: 5.83E-01

Methylation in Case

 2.66E-01 (Median) Methylation in Control 2.36E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A2 in HIV infection [ 7 ]

Location

 TSS1500 (cg12661370)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.62E+00 Statistic Test p-value: 2.34E-02; Z-score: 5.36E-01

Methylation in Case

 7.42E-03 (Median) Methylation in Control 4.59E-03 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A2 in HIV infection [ 7 ]

Location

 TSS1500 (cg02319142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.19E+00 Statistic Test p-value: 2.92E-02; Z-score: 7.83E-01

Methylation in Case

 7.78E-02 (Median) Methylation in Control 6.56E-02 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC26A2 in HIV infection [ 7 ]

Location

 Body (cg19447692)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.36E-02; Z-score: -7.52E-01

Methylation in Case

 9.40E-01 (Median) Methylation in Control 9.54E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in lung adenocarcinoma [ 8 ]

Location

 5'UTR (cg00394021)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 3.75E-02; Z-score: 1.63E+00

Methylation in Case

 2.87E-01 (Median) Methylation in Control 2.25E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in lung adenocarcinoma [ 8 ]

Location

 5'UTR (cg25054311)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.23E+00 Statistic Test p-value: 4.52E-02; Z-score: 2.05E+00

Methylation in Case

 1.49E-01 (Median) Methylation in Control 1.21E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in lung adenocarcinoma [ 8 ]

Location

 TSS1500 (cg02319142)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.14E-02; Z-score: 1.42E+00

Methylation in Case

 1.08E-01 (Median) Methylation in Control 9.23E-02 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in papillary thyroid cancer [ 9 ]

Location

 5'UTR (cg26668000)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 3.63E-02; Z-score: -5.33E-02

Methylation in Case

 8.68E-01 (Median) Methylation in Control 8.69E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in papillary thyroid cancer [ 9 ]

Location

 TSS200 (cg12576153)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 5.53E-03; Z-score: -4.96E-01

Methylation in Case

 4.02E-02 (Median) Methylation in Control 4.37E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in papillary thyroid cancer [ 9 ]

Location

 TSS200 (cg26354587)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.09E-02; Z-score: -3.07E-01

Methylation in Case

 4.16E-02 (Median) Methylation in Control 4.38E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Colon cancer

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in colon adenocarcinoma [ 10 ]

Location

 TSS1500 (cg01119072)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 5.11E-04; Z-score: -9.98E-01

Methylation in Case

 3.71E-01 (Median) Methylation in Control 4.24E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in colon adenocarcinoma [ 10 ]

Location

 TSS200 (cg23834895)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.28E+00 Statistic Test p-value: 1.18E-03; Z-score: 2.04E+00

Methylation in Case

 5.70E-01 (Median) Methylation in Control 4.45E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in colon adenocarcinoma [ 10 ]

Location

 Body (cg09050160)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.22E+00 Statistic Test p-value: 1.18E-04; Z-score: -1.53E+00

Methylation in Case

 5.01E-01 (Median) Methylation in Control 6.13E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A2 in colon adenocarcinoma [ 10 ]

Location

 Body (cg14001035)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.07E-03; Z-score: -1.22E+00

Methylation in Case

 7.20E-01 (Median) Methylation in Control 7.77E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A2 in colon adenocarcinoma [ 10 ]

Location

 Body (cg04996277)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 3.11E-03; Z-score: 1.82E+00

Methylation in Case

 3.37E-01 (Median) Methylation in Control 2.58E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Depression

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in depression [ 11 ]

Location

 TSS1500 (cg12661370)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.09E+00 Statistic Test p-value: 2.91E-02; Z-score: 5.43E-01

Methylation in Case

 5.21E-02 (Median) Methylation in Control 4.76E-02 (Median)

Studied Phenotype

 Depression [ ICD-11: 6A8Z]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in panic disorder [ 12 ]

Location

 TSS1500 (cg13237906)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.92E-01 Statistic Test p-value: 4.78E-02; Z-score: 1.85E-01

Methylation in Case

 -5.27E+00 (Median) Methylation in Control -5.31E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in panic disorder [ 12 ]

Location

 TSS200 (cg20101978)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 9.69E-01 Statistic Test p-value: 4.76E-02; Z-score: 4.58E-01

Methylation in Case

 -4.52E+00 (Median) Methylation in Control -4.66E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in prostate cancer [ 13 ]

Location

 TSS200 (cg07755390)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.61E+00 Statistic Test p-value: 4.79E-02; Z-score: -2.83E+00

Methylation in Case

 6.80E-02 (Median) Methylation in Control 1.09E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in systemic lupus erythematosus [ 14 ]

Location

 TSS200 (cg20540378)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.05E-03; Z-score: -1.61E-01

Methylation in Case

 7.88E-02 (Median) Methylation in Control 8.14E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in systemic lupus erythematosus [ 14 ]

Location

 TSS200 (cg04088893)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.16E-03; Z-score: -1.68E-01

Methylation in Case

 6.80E-02 (Median) Methylation in Control 7.11E-02 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            9 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A2 in pancretic ductal adenocarcinoma [ 15 ]

Location

 Body (cg26138846)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.29E-04; Z-score: -1.01E+00

Methylation in Case

 6.69E-01 (Median) Methylation in Control 7.62E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A2 in pancretic ductal adenocarcinoma [ 15 ]

Location

 Body (cg13641012)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 8.73E-04; Z-score: -8.74E-01

Methylation in Case

 7.55E-01 (Median) Methylation in Control 8.12E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A2 in pancretic ductal adenocarcinoma [ 15 ]

Location

 Body (cg16034787)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 1.99E-03; Z-score: 8.29E-01

Methylation in Case

 9.24E-01 (Median) Methylation in Control 9.17E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A2 in pancretic ductal adenocarcinoma [ 15 ]

Location

 Body (cg20023155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 2.86E-03; Z-score: 2.69E-01

Methylation in Case

 8.98E-01 (Median) Methylation in Control 8.93E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A2 in pancretic ductal adenocarcinoma [ 15 ]

Location

 Body (cg26188818)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 3.40E-03; Z-score: -7.32E-01

Methylation in Case

 7.28E-02 (Median) Methylation in Control 8.00E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC26A2 in pancretic ductal adenocarcinoma [ 15 ]

Location

 Body (cg06592065)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 7.57E-03; Z-score: 6.38E-01

Methylation in Case

 8.53E-01 (Median) Methylation in Control 8.41E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC26A2 in pancretic ductal adenocarcinoma [ 15 ]

Location

 Body (cg01021245)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 1.56E-02; Z-score: 4.37E-01

Methylation in Case

 8.55E-01 (Median) Methylation in Control 8.29E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC26A2 in pancretic ductal adenocarcinoma [ 15 ]

Location

 Body (cg22887467)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.04E-02; Z-score: -3.10E-01

Methylation in Case

 8.45E-01 (Median) Methylation in Control 8.57E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC26A2 in pancretic ductal adenocarcinoma [ 15 ]

Location

 Body (cg25658464)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.29E-02; Z-score: -3.46E-01

Methylation in Case

 8.60E-01 (Median) Methylation in Control 8.71E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

Histone acetylation

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypoacetylation of SLC26A2 in colon cancer (compare with normal counterpart cells) [ 16 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC26A2 Experiment Method RT-qPCR

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Multiple cell lines of human

Additional Notes

 Significant increases in SLC26A2 mRNA were observed when these cancer cells were cultured in the presence of histone deacetylase (HDAC) inhibitors.

Histone trimethylation

  Colon cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Lower level of histone trimethylation of SLC26A2 in colon cancer (compare with normal counterpart cells) [ 16 ]

Location

 Promoter

Epigenetic Type

 Histone trimethylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC26A2 Experiment Method RT-qPCR

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Multiple cell lines of human

Additional Notes

 Loss of H3 lysine 4 methylation was observed in cultured colon cancer cells with diminished SLC26A2 transcription, such as SW480, SW1083, and HT29.

microRNA

  Unclear Phenotype

          61 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-10a directly targets SLC26A2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-10a miRNA Mature ID miR-10a-5p

miRNA Sequence

 UACCCUGUAGAUCCGAAUUUGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-1200 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1200 miRNA Mature ID miR-1200

miRNA Sequence

 CUCCUGAGCCAUUCUGAGCCUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-124 directly targets SLC26A2 [ 19 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-124 miRNA Mature ID miR-124-3p

miRNA Sequence

 UAAGGCACGCGGUGAAUGCCAA

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)

  Epigenetic Phenomenon 4

 miR-1247 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1247 miRNA Mature ID miR-1247-3p

miRNA Sequence

 CCCCGGGAACGUCGAGACUGGAGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-128 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-128 miRNA Mature ID miR-128-3p

miRNA Sequence

 UCACAGUGAACCGGUCUCUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 6

 miR-1289 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1289 miRNA Mature ID miR-1289

miRNA Sequence

 UGGAGUCCAGGAAUCUGCAUUUU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 7

 miR-1297 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1297 miRNA Mature ID miR-1297

miRNA Sequence

 UUCAAGUAAUUCAGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 8

 miR-1303 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1303 miRNA Mature ID miR-1303

miRNA Sequence

 UUUAGAGACGGGGUCUUGCUCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-145 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-145 miRNA Mature ID miR-145-5p

miRNA Sequence

 GUCCAGUUUUCCCAGGAAUCCCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-1825 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-1825 miRNA Mature ID miR-1825

miRNA Sequence

 UCCAGUGCCCUCCUCUCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 11

 miR-192 directly targets SLC26A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-192 miRNA Mature ID miR-192-5p

miRNA Sequence

 CUGACCUAUGAAUUGACAGCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 12

 miR-193b directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-193b miRNA Mature ID miR-193b-5p

miRNA Sequence

 CGGGGUUUUGAGGGCGAGAUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 13

 miR-1976 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

 CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-199a directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-199a miRNA Mature ID miR-199a-5p

miRNA Sequence

 CCCAGUGUUCAGACUACCUGUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-199b directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-199b miRNA Mature ID miR-199b-5p

miRNA Sequence

 CCCAGUGUUUAGACUAUCUGUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-21 directly targets SLC26A2 [ 23 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-21 miRNA Mature ID miR-21-5p

miRNA Sequence

 UAGCUUAUCAGACUGAUGUUGA

miRNA Target Type

 Direct

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 17

 miR-215 directly targets SLC26A2 [ 22 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-5p

miRNA Sequence

 AUGACCUAUGAAUUGACAGAC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 18

 miR-215 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-215 miRNA Mature ID miR-215-3p

miRNA Sequence

 UCUGUCAUUUCUUUAGGCCAAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 19

 miR-216a directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-216a miRNA Mature ID miR-216a-3p

miRNA Sequence

 UCACAGUGGUCUCUGGGAUUAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 20

 miR-216b directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-216b miRNA Mature ID miR-216b-5p

miRNA Sequence

 AAAUCUCUGCAGGCAAAUGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 21

 miR-26a directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-26a miRNA Mature ID miR-26a-5p

miRNA Sequence

 UUCAAGUAAUCCAGGAUAGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 22

 miR-26b directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-26b miRNA Mature ID miR-26b-5p

miRNA Sequence

 UUCAAGUAAUUCAGGAUAGGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 23

 miR-27a directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-27a miRNA Mature ID miR-27a-3p

miRNA Sequence

 UUCACAGUGGCUAAGUUCCGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 24

 miR-27b directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-27b miRNA Mature ID miR-27b-3p

miRNA Sequence

 UUCACAGUGGCUAAGUUCUGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 25

 miR-3135b directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3135b miRNA Mature ID miR-3135b

miRNA Sequence

 GGCUGGAGCGAGUGCAGUGGUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 26

 miR-3152 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3152 miRNA Mature ID miR-3152-3p

miRNA Sequence

 UGUGUUAGAAUAGGGGCAAUAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 27

 miR-3198 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3198 miRNA Mature ID miR-3198

miRNA Sequence

 GUGGAGUCCUGGGGAAUGGAGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 28

 miR-324 directly targets SLC26A2 [ 17 ]

Epigenetic Type

 microRNA Experiment Method CLASH

miRNA Stemloop ID

 miR-324 miRNA Mature ID miR-324-5p

miRNA Sequence

 CGCAUCCCCUAGGGCAUUGGUG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 29

 miR-3652 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3652 miRNA Mature ID miR-3652

miRNA Sequence

 CGGCUGGAGGUGUGAGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 30

 miR-3681 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-3681 miRNA Mature ID miR-3681-3p

miRNA Sequence

 ACACAGUGCUUCAUCCACUACU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 31

 miR-411 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-411 miRNA Mature ID miR-411-5p

miRNA Sequence

 UAGUAGACCGUAUAGCGUACG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 32

 miR-4279 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

 CUCUCCUCCCGGCUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 33

 miR-4294 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4294 miRNA Mature ID miR-4294

miRNA Sequence

 GGGAGUCUACAGCAGGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 34

 miR-4309 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4309 miRNA Mature ID miR-4309

miRNA Sequence

 CUGGAGUCUAGGAUUCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 35

 miR-4324 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4324 miRNA Mature ID miR-4324

miRNA Sequence

 CCCUGAGACCCUAACCUUAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 36

 miR-4430 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4430 miRNA Mature ID miR-4430

miRNA Sequence

 AGGCUGGAGUGAGCGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 37

 miR-4465 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4465 miRNA Mature ID miR-4465

miRNA Sequence

 CUCAAGUAGUCUGACCAGGGGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 38

 miR-4712 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-4712 miRNA Mature ID miR-4712-5p

miRNA Sequence

 UCCAGUACAGGUCUCUCAUUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 39

 miR-4722 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

 ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 40

 miR-483 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-483 miRNA Mature ID miR-483-5p

miRNA Sequence

 AAGACGGGAGGAAAGAAGGGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 41

 miR-500b directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-500b miRNA Mature ID miR-500b-3p

miRNA Sequence

 GCACCCAGGCAAGGAUUCUG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 42

 miR-513a directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-513a miRNA Mature ID miR-513a-5p

miRNA Sequence

 UUCACAGGGAGGUGUCAU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 43

 miR-5195 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5195 miRNA Mature ID miR-5195-3p

miRNA Sequence

 AUCCAGUUCUCUGAGGGGGCU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 44

 miR-544b directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-544b miRNA Mature ID miR-544b

miRNA Sequence

 ACCUGAGGUUGUGCAUUUCUAA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 45

 miR-5571 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5571 miRNA Mature ID miR-5571-5p

miRNA Sequence

 CAAUUCUCAAAGGAGCCUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 46

 miR-5693 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-5693 miRNA Mature ID miR-5693

miRNA Sequence

 GCAGUGGCUCUGAAAUGAACUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 47

 miR-5697 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-5697 miRNA Mature ID miR-5697

miRNA Sequence

 UCAAGUAGUUUCAUGAUAAAGG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 48

 miR-660 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-660 miRNA Mature ID miR-660-3p

miRNA Sequence

 ACCUCCUGUGUGCAUGGAUUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 49

 miR-6727 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

 UCCUGCCACCUCCUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 50

 miR-6747 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

 UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 51

 miR-6773 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6773 miRNA Mature ID miR-6773-3p

miRNA Sequence

 ACUGUCACUUCUCUGCCCAUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 52

 miR-6778 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

 UGCCUCCCUGACAUUCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 53

 miR-6791 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6791 miRNA Mature ID miR-6791-3p

miRNA Sequence

 UGCCUCCUUGGUCUCCGGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 54

 miR-6812 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6812 miRNA Mature ID miR-6812-3p

miRNA Sequence

 CCGCUCUUCCCCUGACCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 55

 miR-6829 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6829 miRNA Mature ID miR-6829-3p

miRNA Sequence

 UGCCUCCUCCGUGGCCUCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 56

 miR-6832 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6832 miRNA Mature ID miR-6832-5p

miRNA Sequence

 AGUAGAGAGGAAAAGUUAGGGUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 57

 miR-6869 directly targets SLC26A2 [ 18 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6869 miRNA Mature ID miR-6869-5p

miRNA Sequence

 GUGAGUAGUGGCGCGCGGCGGC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 58

 miR-6879 directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6879 miRNA Mature ID miR-6879-3p

miRNA Sequence

 UGUCACCCGCUCCUUGCCCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 59

 miR-6887 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-6887 miRNA Mature ID miR-6887-3p

miRNA Sequence

 UCCCCUCCACUUUCCUCCUAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 60

 miR-770 directly targets SLC26A2 [ 20 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-770 miRNA Mature ID miR-770-5p

miRNA Sequence

 UCCAGUACCACGUGUCAGGGCCA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 61

 miR-891a directly targets SLC26A2 [ 21 ]

Epigenetic Type

 microRNA Experiment Method HITS-CLIP

miRNA Stemloop ID

 miR-891a miRNA Mature ID miR-891a-3p

miRNA Sequence

 AGUGGCACAUGUUUGUUGUGAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
10 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
11 DNA methylation and inflammation marker profiles associated with a history of depression. Hum Mol Genet. 2018 Aug 15;27(16):2840-2850.
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
16 Epigenetic silencing of the sulfate transporter gene DTDST induces sialyl Lewisx expression and accelerates proliferation of colon cancer cells. Cancer Res. 2010 May 15;70(10):4064-73.
17 Mapping the human miRNA interactome by CLASH reveals frequent noncanonical binding. Cell. 2013 Apr 25;153(3):654-65.
18 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
19 The impact of microRNAs on protein output. Nature. 2008 Sep 4;455(7209):64-71.
20 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
21 Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
22 Coordinated regulation of cell cycle transcripts by p53-Inducible microRNAs, miR-192 and miR-215. Cancer Res. 2008 Dec 15;68(24):10105-12.
23 MicroRNA 21 promotes glioma invasion by targeting matrix metalloproteinase regulators. Mol Cell Biol. 2008 Sep;28(17):5369-80.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.