Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0231 Transporter Info
Gene Name SLC26A3
Transporter Name Chloride anion exchanger
Gene ID
1811
UniProt ID
P40879
Epigenetic Regulations of This DT (EGR)

Methylation

  Bladder cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A3 in bladder cancer [ 1 ]

Location

 TSS1500 (cg22294577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.74E+00 Statistic Test p-value: 1.42E-10; Z-score: -2.62E+01

Methylation in Case

 4.16E-01 (Median) Methylation in Control 7.24E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A3 in bladder cancer [ 1 ]

Location

 TSS1500 (cg04996020)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.85E+00 Statistic Test p-value: 2.06E-09; Z-score: -2.48E+01

Methylation in Case

 4.11E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A3 in bladder cancer [ 1 ]

Location

 TSS1500 (cg16709217)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 5.08E-06; Z-score: -8.34E+00

Methylation in Case

 6.64E-01 (Median) Methylation in Control 8.21E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A3 in bladder cancer [ 1 ]

Location

 Body (cg12651599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 4.68E-03; Z-score: -8.14E-01

Methylation in Case

 7.97E-01 (Median) Methylation in Control 8.22E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A3 in colorectal cancer [ 2 ]

Location

 TSS1500 (cg16709217)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 2.18E-07; Z-score: -2.04E+00

Methylation in Case

 9.05E-01 (Median) Methylation in Control 9.28E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A3 in colorectal cancer [ 2 ]

Location

 TSS1500 (cg22294577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.69E-04; Z-score: -7.78E-01

Methylation in Case

 8.86E-01 (Median) Methylation in Control 9.02E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

 TSS1500 (cg26153234)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.59E-12; Z-score: -3.02E+00

Methylation in Case

 6.79E-01 (Median) Methylation in Control 8.46E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

 TSS1500 (cg22294577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 1.61E-09; Z-score: -3.80E+00

Methylation in Case

 6.28E-01 (Median) Methylation in Control 7.48E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

 TSS1500 (cg16709217)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 3.09E-08; Z-score: -3.30E+00

Methylation in Case

 7.65E-01 (Median) Methylation in Control 8.36E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

 TSS1500 (cg04996020)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.00E-05; Z-score: -8.90E-01

Methylation in Case

 7.53E-01 (Median) Methylation in Control 7.95E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

 Body (cg17778888)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.47E+00 Statistic Test p-value: 3.17E-13; Z-score: -4.02E+00

Methylation in Case

 6.54E-01 (Median) Methylation in Control 9.59E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC26A3 in hepatocellular carcinoma [ 3 ]

Location

 Body (cg12651599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 2.69E-04; Z-score: -4.27E-01

Methylation in Case

 8.39E-01 (Median) Methylation in Control 8.53E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A3 in lung adenocarcinoma [ 4 ]

Location

 TSS1500 (cg22294577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.87E-02; Z-score: -2.60E+00

Methylation in Case

 6.99E-01 (Median) Methylation in Control 7.57E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A3 in lung adenocarcinoma [ 4 ]

Location

 TSS1500 (cg16709217)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.27E-02; Z-score: -2.36E+00

Methylation in Case

 7.72E-01 (Median) Methylation in Control 8.19E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Panic disorder

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A3 in panic disorder [ 5 ]

Location

 TSS1500 (cg22294577)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 2.64E-02; Z-score: 3.83E-01

Methylation in Case

 2.67E+00 (Median) Methylation in Control 2.47E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A3 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg04996020)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 5.44E-06; Z-score: -1.10E+00

Methylation in Case

 8.32E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC26A3 in papillary thyroid cancer [ 6 ]

Location

 TSS1500 (cg16709217)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.01E-02; Z-score: -3.72E-01

Methylation in Case

 8.44E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC26A3 in papillary thyroid cancer [ 6 ]

Location

 Body (cg12651599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 9.53E-03; Z-score: -2.78E-01

Methylation in Case

 9.13E-01 (Median) Methylation in Control 9.19E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A3 in breast cancer [ 7 ]

Location

 Body (cg12651599)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.21E+00 Statistic Test p-value: 7.05E-24; Z-score: 2.92E+00

Methylation in Case

 8.51E-01 (Median) Methylation in Control 7.02E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC26A3 in prostate cancer [ 8 ]

Location

 Body (cg07587250)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.17E+00 Statistic Test p-value: 2.62E-03; Z-score: 8.10E+00

Methylation in Case

 8.81E-01 (Median) Methylation in Control 7.54E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-335 directly targets SLC26A3 [ 9 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 2

 miR-7 directly targets SLC26A3 [ 10 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-7 miRNA Mature ID miR-7-5p

miRNA Sequence

 UGGAAGACUAGUGAUUUUGUUGUU

miRNA Target Type

 Direct

Experimental Material

 Human cervical cancer cell line (Hela)
References
1 DNA Methylation Dynamics in Urological Tumors.
2 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
3 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
4 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
5 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
6 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
7 Genome-wide Scan for Methylation Profiles in Breast Cancer
8 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
9 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
10 MicroRNA targeting specificity in mammals: determinants beyond seed pairing. Mol Cell. 2007 Jul 6;27(1):91-105.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.