Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID	DTD0237 Transporter Info
Gene Name	SLC26A9
Transporter Name	Anion transporter/exchanger protein 9
Gene ID	115019
UniProt ID	Q7LBE3

Epigenetic Regulations of This DT (EGR)
microRNA
Unclear Phenotype	44 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	miR-1321 directly targets SLC26A9			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-1321	miRNA Mature ID	miR-1321
miRNA Sequence	CAGGGAGGUGAAUGUGAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 2	miR-185 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-185	miRNA Mature ID	miR-185-5p
miRNA Sequence	UGGAGAGAAAGGCAGUUCCUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 3	miR-302b directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302b	miRNA Mature ID	miR-302b-5p
miRNA Sequence	ACUUUAACAUGGAAGUGCUUUC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 4	miR-302d directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-302d	miRNA Mature ID	miR-302d-5p
miRNA Sequence	ACUUUAACAUGGAGGCACUUGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 5	miR-3065 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3065	miRNA Mature ID	miR-3065-3p
miRNA Sequence	UCAGCACCAGGAUAUUGUUGGAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 6	miR-3125 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3125	miRNA Mature ID	miR-3125
miRNA Sequence	UAGAGGAAGCUGUGGAGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 7	miR-3150b directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3150b	miRNA Mature ID	miR-3150b-3p
miRNA Sequence	UGAGGAGAUCGUCGAGGUUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 8	miR-3175 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3175	miRNA Mature ID	miR-3175
miRNA Sequence	CGGGGAGAGAACGCAGUGACGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 9	miR-3187 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-3187	miRNA Mature ID	miR-3187-3p
miRNA Sequence	UUGGCCAUGGGGCUGCGCGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 10	miR-3202 directly targets SLC26A9			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3202	miRNA Mature ID	miR-3202
miRNA Sequence	UGGAAGGGAGAAGAGCUUUAAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 11	miR-3914 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3914	miRNA Mature ID	miR-3914
miRNA Sequence	AAGGAACCAGAAAAUGAGAAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 12	miR-3916 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3916	miRNA Mature ID	miR-3916
miRNA Sequence	AAGAGGAAGAAAUGGCUGGUUCUCAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 13	miR-3928 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-3928	miRNA Mature ID	miR-3928-3p
miRNA Sequence	GGAGGAACCUUGGAGCUUCGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 14	miR-4306 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4306	miRNA Mature ID	miR-4306
miRNA Sequence	UGGAGAGAAAGGCAGUA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 15	miR-4435 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4435	miRNA Mature ID	miR-4435
miRNA Sequence	AUGGCCAGAGCUCACACAGAGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 16	miR-4476 directly targets SLC26A9			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4476	miRNA Mature ID	miR-4476
miRNA Sequence	CAGGAAGGAUUUAGGGACAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 17	miR-4640 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4640	miRNA Mature ID	miR-4640-3p
miRNA Sequence	CACCCCCUGUUUCCUGGCCCAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 18	miR-4644 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4644	miRNA Mature ID	miR-4644
miRNA Sequence	UGGAGAGAGAAAAGAGACAGAAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 19	miR-4667 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4667	miRNA Mature ID	miR-4667-3p
miRNA Sequence	UCCCUCCUUCUGUCCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 20	miR-4701 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4701	miRNA Mature ID	miR-4701-5p
miRNA Sequence	UUGGCCACCACACCUACCCCUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 21	miR-4716 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4716	miRNA Mature ID	miR-4716-3p
miRNA Sequence	AAGGGGGAAGGAAACAUGGAGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 22	miR-4723 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4723	miRNA Mature ID	miR-4723-5p
miRNA Sequence	UGGGGGAGCCAUGAGAUAAGAGCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 23	miR-4739 directly targets SLC26A9			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4739	miRNA Mature ID	miR-4739
miRNA Sequence	AAGGGAGGAGGAGCGGAGGGGCCCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 24	miR-4756 directly targets SLC26A9			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4756	miRNA Mature ID	miR-4756-5p
miRNA Sequence	CAGGGAGGCGCUCACUCUCUGCU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 25	miR-4764 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-4764	miRNA Mature ID	miR-4764-3p
miRNA Sequence	UUAACUCCUUUCACACCCAUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 26	miR-4784 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-4784	miRNA Mature ID	miR-4784
miRNA Sequence	UGAGGAGAUGCUGGGACUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 27	miR-548s directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-548s	miRNA Mature ID	miR-548s
miRNA Sequence	AUGGCCAAAACUGCAGUUAUUUU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 28	miR-5698 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-5698	miRNA Mature ID	miR-5698
miRNA Sequence	UGGGGGAGUGCAGUGAUUGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 29	miR-588 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-588	miRNA Mature ID	miR-588
miRNA Sequence	UUGGCCACAAUGGGUUAGAAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 30	miR-618 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-618	miRNA Mature ID	miR-618
miRNA Sequence	AAACUCUACUUGUCCUUCUGAGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 31	miR-6731 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6731	miRNA Mature ID	miR-6731-5p
miRNA Sequence	UGGGAGAGCAGGGUAUUGUGGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 32	miR-6758 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6758	miRNA Mature ID	miR-6758-5p
miRNA Sequence	UAGAGAGGGGAAGGAUGUGAUGU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 33	miR-6794 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6794	miRNA Mature ID	miR-6794-5p
miRNA Sequence	CAGGGGGACUGGGGGUGAGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 34	miR-6856 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6856	miRNA Mature ID	miR-6856-5p
miRNA Sequence	AAGAGAGGAGCAGUGGUGCUGUGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 35	miR-6859 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6859	miRNA Mature ID	miR-6859-5p
miRNA Sequence	GAGAGGAACAUGGGCUCAGGACA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 36	miR-6870 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6870	miRNA Mature ID	miR-6870-5p
miRNA Sequence	UGGGGGAGAUGGGGGUUGA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 37	miR-6871 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6871	miRNA Mature ID	miR-6871-3p
miRNA Sequence	CAGCACCCUGUGGCUCCCACAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 38	miR-6876 directly targets SLC26A9			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-6876	miRNA Mature ID	miR-6876-5p
miRNA Sequence	CAGGAAGGAGACAGGCAGUUCA
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 39	miR-6887 directly targets SLC26A9			[ 3 ]
Epigenetic Type	microRNA	Experiment Method	HITS-CLIP
miRNA Stemloop ID	miR-6887	miRNA Mature ID	miR-6887-3p
miRNA Sequence	UCCCCUCCACUUUCCUCCUAG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 40	miR-7106 directly targets SLC26A9			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7106	miRNA Mature ID	miR-7106-5p
miRNA Sequence	UGGGAGGAGGGGAUCUUGGG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 41	miR-7111 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7111	miRNA Mature ID	miR-7111-5p
miRNA Sequence	UGGGGGAGGAAGGACAGGCCAU
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 42	miR-7515 directly targets SLC26A9			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-7515	miRNA Mature ID	miR-7515
miRNA Sequence	AGAAGGGAAGAUGGUGAC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 43	miR-765 directly targets SLC26A9			[ 1 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-765	miRNA Mature ID	miR-765
miRNA Sequence	UGGAGGAGAAGGAAGGUGAUG
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Epigenetic Phenomenon 44	miR-8085 directly targets SLC26A9			[ 2 ]
Epigenetic Type	microRNA	Experiment Method	PAR-CLIP
miRNA Stemloop ID	miR-8085	miRNA Mature ID	miR-8085
miRNA Sequence	UGGGAGAGAGGACUGUGAGGC
miRNA Target Type	Direct
Experimental Material	Multiple cell lines of human
Methylation
Liver cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant/significant hypermethylation of SLC26A9 in liver cancer than that in healthy individual/adjacent tissue
Studied Phenotype	Liver cancer [ICD-11:2C12]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.93E-11; Fold-change: -0.371479338; Z-score: -2.185370184
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 1.13E-17; Fold-change: -0.396091941; Z-score: -7.649001796
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section
Peripheral neuroectodermal tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC26A9 in peripheral neuroectodermal tumour than that in healthy individual
Studied Phenotype	Peripheral neuroectodermal tumour [ICD-11:2B52]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.011551441; Fold-change: 0.282891522; Z-score: 0.836031628
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Pulmonary hypertension	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypermethylation of SLC26A9 in pulmonary hypertension than that in healthy individual
Studied Phenotype	Pulmonary hypertension [ICD-11:BB01]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.016234259; Fold-change: 0.246981524; Z-score: 2.425512893
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Melanoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC26A9 in melanoma than that in healthy individual
Studied Phenotype	Melanoma [ICD-11:2C30]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000221784; Fold-change: -0.23702148; Z-score: -11.5345965
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Obesity	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC26A9 in obesity than that in healthy individual
Studied Phenotype	Obesity [ICD-11:5B81]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.88E-07; Fold-change: -0.236241857; Z-score: -3.08540699
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Ovarian cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC26A9 in ovarian cancer than that in healthy individual
Studied Phenotype	Ovarian cancer [ICD-11:2C73]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.014071479; Fold-change: -0.253133791; Z-score: -1.127840331
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Arterial aneurysm	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC26A9 in arterial aneurysm than that in healthy individual
Studied Phenotype	Arterial aneurysm [ICD-11:BD51]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000267469; Fold-change: 0.706624502; Z-score: 1.899896576
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Atypical teratoid rhabdoid tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC26A9 in atypical teratoid rhabdoid tumour than that in healthy individual
Studied Phenotype	Atypical teratoid rhabdoid tumour [ICD-11:2A00.1Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 1.39E-07; Fold-change: 0.436197209; Z-score: 1.28832318
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer metastasis	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC26A9 in prostate cancer metastasis than that in healthy individual
Studied Phenotype	Prostate cancer metastasis [ICD-11:2.00E+06]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 0.000361349; Fold-change: 0.453903588; Z-score: 4.627337545
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Prostate cancer	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypermethylation of SLC26A9 in prostate cancer than that in healthy individual
Studied Phenotype	Prostate cancer [ICD-11:2C82]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.95E-07; Fold-change: 0.461784475; Z-score: 3.266756661
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroblastoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC26A9 in brain neuroblastoma than that in healthy individual
Studied Phenotype	Brain neuroblastoma [ICD-11:2A00.11]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 3.29E-10; Fold-change: -0.408997771; Z-score: -1.163699696
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Brain neuroepithelial tumour	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC26A9 in brain neuroepithelial tumour than that in healthy individual
Studied Phenotype	Brain neuroepithelial tumour [ICD-11:2A00.2Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 9.86E-11; Fold-change: -0.491677721; Z-score: -1.612321906
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Posterior fossa ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC26A9 in posterior fossa ependymoma than that in healthy individual
Studied Phenotype	Posterior fossa ependymoma [ICD-11:2D50.2]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 4.22E-48; Fold-change: -0.483042883; Z-score: -1.86178338
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
RELA YAP fusion ependymoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC26A9 in rela yap fusion ependymoma than that in healthy individual
Studied Phenotype	RELA YAP fusion ependymoma [ICD-11:2A00.0Y]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.55E-13; Fold-change: -0.35999925; Z-score: -1.299436665
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
			Please Click the above Thumbnail to View/Download the Methylation Barchart for All Samples
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual
Vestibular melanotic schwannoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Significant hypomethylation of SLC26A9 in vestibular melanotic schwannoma than that in healthy individual
Studied Phenotype	Vestibular melanotic schwannoma [ICD-11:2A02.3]
The Methylation Level of Disease Section Compare with the Healthy Individual	p-value: 2.17E-05; Fold-change: -0.307898545; Z-score: -4.497786905
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue adjacent to the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data of patients in the normal section of the tissue adjacent to the disease section Download DT methylation data in the tissue of healthy individual
Renal cell carcinoma	1 Epigenetic Phenomena Related to This Phenotype		Click to Show/Hide the Full List
Epigenetic Phenomenon 1	Moderate hypomethylation of SLC26A9 in renal cell carcinoma than that in adjacent tissue
Studied Phenotype	Renal cell carcinoma [ICD-11:2C90]
The Methylation Level of Disease Section Compare with the Adjacent Tissue	p-value: 0.000599789; Fold-change: -0.236917322; Z-score: -1.485921732
DT methylation level in the diseased tissue of patients DT methylation level in the normal tissue of healthy individuals DT methylation level in tissue other than the diseased tissue of patients
Download DT methylation data of patients in the disease section of the tissue Download DT methylation data in the tissue of healthy individual Download DT methylation data in the tissue of the other disease section

References
1	In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
2	TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
3	Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.

Detail Information of Epigenetic Regulations

Visitor Map

Correspondence