Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0239 Transporter Info | ||||
| Gene Name | SLC27A2 | ||||
| Transporter Name | Very long-chain acyl-CoA synthetase | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
microRNA |
|||||
|
Unclear Phenotype |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
let-7b directly targets SLC27A2 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
|
miRNA Stemloop ID |
let-7b | miRNA Mature ID | let-7b-5p | ||
|
miRNA Sequence |
UGAGGUAGUAGGUUGUGUGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 2 |
miR-155 directly targets SLC27A2 | [ 1 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
|
miRNA Stemloop ID |
miR-155 | miRNA Mature ID | miR-155-5p | ||
|
miRNA Sequence |
UUAAUGCUAAUCGUGAUAGGGGUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
|
Epigenetic Phenomenon 3 |
miR-204 directly targets SLC27A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-204 | miRNA Mature ID | miR-204-5p | ||
|
miRNA Sequence |
UUCCCUUUGUCAUCCUAUGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 4 |
miR-211 directly targets SLC27A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-211 | miRNA Mature ID | miR-211-5p | ||
|
miRNA Sequence |
UUCCCUUUGUCAUCCUUCGCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 5 |
miR-3184 directly targets SLC27A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3184 | miRNA Mature ID | miR-3184-3p | ||
|
miRNA Sequence |
AAAGUCUCGCUCUCUGCCCCUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-4287 directly targets SLC27A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4287 | miRNA Mature ID | miR-4287 | ||
|
miRNA Sequence |
UCUCCCUUGAGGGCACUUU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-4469 directly targets SLC27A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4469 | miRNA Mature ID | miR-4469 | ||
|
miRNA Sequence |
GCUCCCUCUAGGGUCGCUCGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 8 |
miR-4685 directly targets SLC27A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4685 | miRNA Mature ID | miR-4685-3p | ||
|
miRNA Sequence |
UCUCCCUUCCUGCCCUGGCUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 9 |
miR-6832 directly targets SLC27A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6832 | miRNA Mature ID | miR-6832-3p | ||
|
miRNA Sequence |
ACCCUUUUUCUCUUUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 10 |
miR-6867 directly targets SLC27A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6867 | miRNA Mature ID | miR-6867-3p | ||
|
miRNA Sequence |
CUCUCCCUCUUUACCCACUAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-7113 directly targets SLC27A2 | [ 2 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7113 | miRNA Mature ID | miR-7113-3p | ||
|
miRNA Sequence |
CCUCCCUGCCCGCCUCUCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Methylation |
|||||
|
Brain neuroepithelial tumour |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC27A2 in brain neuroepithelial tumour than that in healthy individual | ||||
Studied Phenotype |
Brain neuroepithelial tumour [ICD-11:2A00.2Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.37E-09; Fold-change: -0.270292311; Z-score: -5.395696556 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC27A2 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000900804; Fold-change: -0.294387044; Z-score: -3.728760186 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Chronic obstructive pulmonary disease |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC27A2 in chronic obstructive pulmonary disease than that in healthy individual | ||||
Studied Phenotype |
Chronic obstructive pulmonary disease [ICD-11:CA22] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.014822483; Fold-change: -0.200085975; Z-score: -1.411901064 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Melanoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC27A2 in melanoma than that in healthy individual | ||||
Studied Phenotype |
Melanoma [ICD-11:2C30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000750984; Fold-change: -0.228906794; Z-score: -1.776139934 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
|
Melanocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC27A2 in melanocytoma than that in healthy individual | ||||
Studied Phenotype |
Melanocytoma [ICD-11:2F36.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 5.50E-13; Fold-change: -0.558301839; Z-score: -9.443902786 | ||||
|
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
|
Please Click the above Thumbnail to View/Download
the Methylation Barchart for All Samples
|
||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.