Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0244 Transporter Info | ||||
Gene Name | SLC28A1 | ||||
Transporter Name | Concentrative nucleoside transporter 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
Methylation |
|||||
Hepatocellular carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC28A1 in hepatocellular carcinoma | [ 1 ] | |||
Location |
Body (cg20023155) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 1.76E-15; Z-score: -8.83E+00 | ||
Methylation in Case |
6.06E-01 (Median) | Methylation in Control | 9.18E-01 (Median) | ||
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC28A1 in prostate cancer | [ 2 ] | |||
Location |
Body (cg25194194) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 2.31E-02; Z-score: 2.05E+00 | ||
Methylation in Case |
9.05E-01 (Median) | Methylation in Control | 8.66E-01 (Median) | ||
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
Experimental Material |
Patient tissue samples | ||||
Atypical teratoid rhabdoid tumor |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC28A1 in atypical teratoid rhabdoid tumor | [ 3 ] | |||
Location |
3'UTR (cg24945881) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: 1.51E+00 | Statistic Test | p-value: 1.78E-09; Z-score: 1.69E+00 | ||
Methylation in Case |
4.70E-01 (Median) | Methylation in Control | 3.11E-01 (Median) | ||
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
Experimental Material |
Patient tissue samples | ||||
Bladder cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC28A1 in bladder cancer | [ 4 ] | |||
Location |
3'UTR (cg24945881) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.00E+00 | Statistic Test | p-value: 1.98E-02; Z-score: -5.95E-02 | ||
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 7.18E-01 (Median) | ||
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
Experimental Material |
Patient tissue samples | ||||
Breast cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC28A1 in breast cancer | [ 5 ] | |||
Location |
3'UTR (cg24945881) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.11E-10; Z-score: -1.69E+00 | ||
Methylation in Case |
7.16E-01 (Median) | Methylation in Control | 7.83E-01 (Median) | ||
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
Experimental Material |
Patient tissue samples | ||||
Colorectal cancer |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC28A1 in colorectal cancer | [ 6 ] | |||
Location |
3'UTR (cg24945881) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.42E-03; Z-score: -4.20E-01 | ||
Methylation in Case |
8.89E-01 (Median) | Methylation in Control | 8.95E-01 (Median) | ||
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
Experimental Material |
Patient tissue samples | ||||
Lung adenocarcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC28A1 in lung adenocarcinoma | [ 7 ] | |||
Location |
3'UTR (cg24945881) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 9.19E-03; Z-score: -2.49E+00 | ||
Methylation in Case |
7.55E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
Experimental Material |
Patient tissue samples | ||||
Papillary thyroid cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Methylation of SLC28A1 in papillary thyroid cancer | [ 8 ] | |||
Location |
3'UTR (cg24945881) | ||||
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
Methylation Fold Change |
Fold Change: -1.03E+00 | Statistic Test | p-value: 9.66E-03; Z-score: -7.65E-01 | ||
Methylation in Case |
8.09E-01 (Median) | Methylation in Control | 8.31E-01 (Median) | ||
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
Experimental Material |
Patient tissue samples | ||||
Prostate cancer metastasis |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypermethylation of SLC28A1 in prostate cancer metastasis than that in healthy individual | ||||
Studied Phenotype |
Prostate cancer metastasis [ICD-11:2.00E+06] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.000629878; Fold-change: 0.258551096; Z-score: 5.094875624 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Brain neuroblastoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC28A1 in brain neuroblastoma than that in healthy individual | ||||
Studied Phenotype |
Brain neuroblastoma [ICD-11:2A00.11] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 1.27E-14; Fold-change: -0.263286059; Z-score: -2.320729253 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Cerebellar liponeurocytoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC28A1 in cerebellar liponeurocytoma than that in healthy individual | ||||
Studied Phenotype |
Cerebellar liponeurocytoma [ICD-11:2A00.0Y] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.008684741; Fold-change: -0.227054797; Z-score: -1.318359979 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Chordoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC28A1 in chordoma than that in healthy individual | ||||
Studied Phenotype |
Chordoma [ICD-11:5A61.0] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 0.002002364; Fold-change: -0.273766242; Z-score: -9.330544424 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Lymphoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Moderate hypomethylation of SLC28A1 in lymphoma than that in healthy individual | ||||
Studied Phenotype |
Lymphoma [ICD-11:2B30] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 3.94E-09; Fold-change: -0.277457671; Z-score: -3.144490514 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
Posterior fossa ependymoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
Significant hypomethylation of SLC28A1 in posterior fossa ependymoma than that in healthy individual | ||||
Studied Phenotype |
Posterior fossa ependymoma [ICD-11:2D50.2] | ||||
The Methylation Level of Disease Section Compare with the Healthy Individual |
p-value: 2.68E-194; Fold-change: -0.343948709; Z-score: -5.634705005 | ||||
DT methylation level in the diseased tissue of patients
DT methylation level in the normal tissue of healthy individuals
|
|||||
![]() |
![]() |
||||
microRNA |
|||||
Unclear Phenotype |
83 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-103a directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-103a | miRNA Mature ID | miR-103a-3p | ||
miRNA Sequence |
AGCAGCAUUGUACAGGGCUAUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 2 |
miR-106a directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-106a | miRNA Mature ID | miR-106a-5p | ||
miRNA Sequence |
AAAAGUGCUUACAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 3 |
miR-106b directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-106b | miRNA Mature ID | miR-106b-5p | ||
miRNA Sequence |
UAAAGUGCUGACAGUGCAGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 4 |
miR-107 directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-107 | miRNA Mature ID | miR-107 | ||
miRNA Sequence |
AGCAGCAUUGUACAGGGCUAUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 5 |
miR-1193 directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1193 | miRNA Mature ID | miR-1193 | ||
miRNA Sequence |
GGGAUGGUAGACCGGUGACGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
miR-1224 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-1224 | miRNA Mature ID | miR-1224-3p | ||
miRNA Sequence |
CCCCACCUCCUCUCUCCUCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-1225 directly targets SLC28A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1225 | miRNA Mature ID | miR-1225-5p | ||
miRNA Sequence |
GUGGGUACGGCCCAGUGGGGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-1244 directly targets SLC28A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1244 | miRNA Mature ID | miR-1244 | ||
miRNA Sequence |
AAGUAGUUGGUUUGUAUGAGAUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-1245b directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1245b | miRNA Mature ID | miR-1245b-3p | ||
miRNA Sequence |
UCAGAUGAUCUAAAGGCCUAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 10 |
miR-1261 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1261 | miRNA Mature ID | miR-1261 | ||
miRNA Sequence |
AUGGAUAAGGCUUUGGCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 11 |
miR-1301 directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1301 | miRNA Mature ID | miR-1301-3p | ||
miRNA Sequence |
UUGCAGCUGCCUGGGAGUGACUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 12 |
miR-17 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-17 | miRNA Mature ID | miR-17-5p | ||
miRNA Sequence |
CAAAGUGCUUACAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 13 |
miR-186 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-5p | ||
miRNA Sequence |
CAAAGAAUUCUCCUUUUGGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 14 |
miR-20a directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-20a | miRNA Mature ID | miR-20a-5p | ||
miRNA Sequence |
UAAAGUGCUUAUAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 15 |
miR-20b directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-20b | miRNA Mature ID | miR-20b-5p | ||
miRNA Sequence |
CAAAGUGCUCAUAGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 16 |
miR-26b directly targets SLC28A1 | [ 14 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-26b | miRNA Mature ID | miR-26b-5p | ||
miRNA Sequence |
UUCAAGUAAUUCAGGAUAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 17 |
miR-302a directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-302a | miRNA Mature ID | miR-302a-3p | ||
miRNA Sequence |
UAAGUGCUUCCAUGUUUUGGUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 18 |
miR-302b directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-302b | miRNA Mature ID | miR-302b-3p | ||
miRNA Sequence |
UAAGUGCUUCCAUGUUUUAGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 19 |
miR-302c directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-302c | miRNA Mature ID | miR-302c-3p | ||
miRNA Sequence |
UAAGUGCUUCCAUGUUUCAGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-302d directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-302d | miRNA Mature ID | miR-302d-3p | ||
miRNA Sequence |
UAAGUGCUUCCAUGUUUGAGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 21 |
miR-302e directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-302e | miRNA Mature ID | miR-302e | ||
miRNA Sequence |
UAAGUGCUUCCAUGCUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 22 |
miR-3130 directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3130 | miRNA Mature ID | miR-3130-3p | ||
miRNA Sequence |
GCUGCACCGGAGACUGGGUAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 23 |
miR-3133 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3133 | miRNA Mature ID | miR-3133 | ||
miRNA Sequence |
UAAAGAACUCUUAAAACCCAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 24 |
miR-3194 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3194 | miRNA Mature ID | miR-3194-5p | ||
miRNA Sequence |
GGCCAGCCACCAGGAGGGCUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 25 |
miR-3663 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3663 | miRNA Mature ID | miR-3663-5p | ||
miRNA Sequence |
GCUGGUCUGCGUGGUGCUCGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 26 |
miR-3682 directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3682 | miRNA Mature ID | miR-3682-5p | ||
miRNA Sequence |
CUACUUCUACCUGUGUUAUCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 27 |
miR-371a directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-371a | miRNA Mature ID | miR-371a-5p | ||
miRNA Sequence |
ACUCAAACUGUGGGGGCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 28 |
miR-371b directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-371b | miRNA Mature ID | miR-371b-5p | ||
miRNA Sequence |
ACUCAAAAGAUGGCGGCACUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 29 |
miR-372 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-372 | miRNA Mature ID | miR-372-5p | ||
miRNA Sequence |
CCUCAAAUGUGGAGCACUAUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 30 |
miR-372 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-372 | miRNA Mature ID | miR-372-3p | ||
miRNA Sequence |
AAAGUGCUGCGACAUUUGAGCGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 31 |
miR-373 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-373 | miRNA Mature ID | miR-373-5p | ||
miRNA Sequence |
ACUCAAAAUGGGGGCGCUUUCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 32 |
miR-373 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-373 | miRNA Mature ID | miR-373-3p | ||
miRNA Sequence |
GAAGUGCUUCGAUUUUGGGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 33 |
miR-378a directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-378a | miRNA Mature ID | miR-378a-5p | ||
miRNA Sequence |
CUCCUGACUCCAGGUCCUGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 34 |
miR-421 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-421 | miRNA Mature ID | miR-421 | ||
miRNA Sequence |
AUCAACAGACAUUAAUUGGGCGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 35 |
miR-4253 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4253 | miRNA Mature ID | miR-4253 | ||
miRNA Sequence |
AGGGCAUGUCCAGGGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 36 |
miR-4275 directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4275 | miRNA Mature ID | miR-4275 | ||
miRNA Sequence |
CCAAUUACCACUUCUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 37 |
miR-432 directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-432 | miRNA Mature ID | miR-432-3p | ||
miRNA Sequence |
CUGGAUGGCUCCUCCAUGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 38 |
miR-433 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-433 | miRNA Mature ID | miR-433-3p | ||
miRNA Sequence |
AUCAUGAUGGGCUCCUCGGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 39 |
miR-4470 directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4470 | miRNA Mature ID | miR-4470 | ||
miRNA Sequence |
UGGCAAACGUGGAAGCCGAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 40 |
miR-4506 directly targets SLC28A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4506 | miRNA Mature ID | miR-4506 | ||
miRNA Sequence |
AAAUGGGUGGUCUGAGGCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 41 |
miR-4703 directly targets SLC28A1 | [ 12 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4703 | miRNA Mature ID | miR-4703-3p | ||
miRNA Sequence |
UGUAGUUGUAUUGUAUUGCCAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 42 |
miR-4709 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4709 | miRNA Mature ID | miR-4709-5p | ||
miRNA Sequence |
ACAACAGUGACUUGCUCUCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 43 |
miR-4731 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4731 | miRNA Mature ID | miR-4731-5p | ||
miRNA Sequence |
UGCUGGGGGCCACAUGAGUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 44 |
miR-4731 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4731 | miRNA Mature ID | miR-4731-3p | ||
miRNA Sequence |
CACACAAGUGGCCCCCAACACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 45 |
miR-4789 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4789 | miRNA Mature ID | miR-4789-5p | ||
miRNA Sequence |
GUAUACACCUGAUAUGUGUAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 46 |
miR-4790 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4790 | miRNA Mature ID | miR-4790-3p | ||
miRNA Sequence |
UGAAUGGUAAAGCGAUGUCACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 47 |
miR-4793 directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4793 | miRNA Mature ID | miR-4793-3p | ||
miRNA Sequence |
UCUGCACUGUGAGUUGGCUGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 48 |
miR-4801 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4801 | miRNA Mature ID | miR-4801 | ||
miRNA Sequence |
UACACAAGAAAACCAAGGCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 49 |
miR-4802 directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4802 | miRNA Mature ID | miR-4802-3p | ||
miRNA Sequence |
UACAUGGAUGGAAACCUUCAAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 50 |
miR-490 directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-490 | miRNA Mature ID | miR-490-5p | ||
miRNA Sequence |
CCAUGGAUCUCCAGGUGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 51 |
miR-497 directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-497 | miRNA Mature ID | miR-497-3p | ||
miRNA Sequence |
CAAACCACACUGUGGUGUUAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 52 |
miR-5047 directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5047 | miRNA Mature ID | miR-5047 | ||
miRNA Sequence |
UUGCAGCUGCGGUUGUAAGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 53 |
miR-5089 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5089 | miRNA Mature ID | miR-5089-5p | ||
miRNA Sequence |
GUGGGAUUUCUGAGUAGCAUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 54 |
miR-512 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-512 | miRNA Mature ID | miR-512-3p | ||
miRNA Sequence |
AAGUGCUGUCAUAGCUGAGGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 55 |
miR-5197 directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5197 | miRNA Mature ID | miR-5197-5p | ||
miRNA Sequence |
CAAUGGCACAAACUCAUUCUUGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 56 |
miR-519d directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-519d | miRNA Mature ID | miR-519d-3p | ||
miRNA Sequence |
CAAAGUGCCUCCCUUUAGAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 57 |
miR-520a directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-520a | miRNA Mature ID | miR-520a-3p | ||
miRNA Sequence |
AAAGUGCUUCCCUUUGGACUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 58 |
miR-520c directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-520c | miRNA Mature ID | miR-520c-3p | ||
miRNA Sequence |
AAAGUGCUUCCUUUUAGAGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 59 |
miR-520d directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-520d | miRNA Mature ID | miR-520d-3p | ||
miRNA Sequence |
AAAGUGCUUCUCUUUGGUGGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 60 |
miR-520g directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-520g | miRNA Mature ID | miR-520g-3p | ||
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 61 |
miR-520h directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-520h | miRNA Mature ID | miR-520h | ||
miRNA Sequence |
ACAAAGUGCUUCCCUUUAGAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 62 |
miR-526b directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-526b | miRNA Mature ID | miR-526b-3p | ||
miRNA Sequence |
GAAAGUGCUUCCUUUUAGAGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 63 |
miR-544a directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-544a | miRNA Mature ID | miR-544a | ||
miRNA Sequence |
AUUCUGCAUUUUUAGCAAGUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 64 |
miR-548aa directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548aa | miRNA Mature ID | miR-548aa | ||
miRNA Sequence |
AAAAACCACAAUUACUUUUGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 65 |
miR-548t directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548t | miRNA Mature ID | miR-548t-3p | ||
miRNA Sequence |
AAAAACCACAAUUACUUUUGCACCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 66 |
miR-5589 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5589 | miRNA Mature ID | miR-5589-5p | ||
miRNA Sequence |
GGCUGGGUGCUCUUGUGCAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 67 |
miR-5683 directly targets SLC28A1 | [ 13 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-5683 | miRNA Mature ID | miR-5683 | ||
miRNA Sequence |
UACAGAUGCAGAUUCUCUGACUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 68 |
miR-6131 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6131 | miRNA Mature ID | miR-6131 | ||
miRNA Sequence |
GGCUGGUCAGAUGGGAGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 69 |
miR-616 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-616 | miRNA Mature ID | miR-616-5p | ||
miRNA Sequence |
ACUCAAAACCCUUCAGUGACUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 70 |
miR-619 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-619 | miRNA Mature ID | miR-619-5p | ||
miRNA Sequence |
GCUGGGAUUACAGGCAUGAGCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 71 |
miR-640 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-640 | miRNA Mature ID | miR-640 | ||
miRNA Sequence |
AUGAUCCAGGAACCUGCCUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 72 |
miR-6506 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6506 | miRNA Mature ID | miR-6506-5p | ||
miRNA Sequence |
ACUGGGAUGUCACUGAAUAUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 73 |
miR-6516 directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6516 | miRNA Mature ID | miR-6516-5p | ||
miRNA Sequence |
UUUGCAGUAACAGGUGUGAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 74 |
miR-6790 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6790 | miRNA Mature ID | miR-6790-3p | ||
miRNA Sequence |
CGACCUCGGCGACCCCUCACU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 75 |
miR-6807 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6807 | miRNA Mature ID | miR-6807-5p | ||
miRNA Sequence |
GUGAGCCAGUGGAAUGGAGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 76 |
miR-6821 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6821 | miRNA Mature ID | miR-6821-3p | ||
miRNA Sequence |
UGACCUCUCCGCUCCGCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 77 |
miR-6843 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6843 | miRNA Mature ID | miR-6843-3p | ||
miRNA Sequence |
AUGGUCUCCUGUUCUCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 78 |
miR-6848 directly targets SLC28A1 | [ 11 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6848 | miRNA Mature ID | miR-6848-3p | ||
miRNA Sequence |
GUGGUCUCUUGGCCCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 79 |
miR-6849 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6849 | miRNA Mature ID | miR-6849-3p | ||
miRNA Sequence |
ACCAGCCUGUGUCCACCUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 80 |
miR-6862 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6862 | miRNA Mature ID | miR-6862-5p | ||
miRNA Sequence |
CGGGCAUGCUGGGAGAGACUUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 81 |
miR-7156 directly targets SLC28A1 | [ 9 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7156 | miRNA Mature ID | miR-7156-3p | ||
miRNA Sequence |
CUGCAGCCACUUGGGGAACUGGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 82 |
miR-767 directly targets SLC28A1 | [ 15 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-767 | miRNA Mature ID | miR-767-5p | ||
miRNA Sequence |
UGCACCAUGGUUGUCUGAGCAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 83 |
miR-93 directly targets SLC28A1 | [ 10 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-93 | miRNA Mature ID | miR-93-5p | ||
miRNA Sequence |
CAAAGUGCUGUUCGUGCAGGUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.