Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0245 Transporter Info
Gene Name SLC28A2
Transporter Name Concentrative nucleoside transporter 2
Gene ID
9153
UniProt ID
O43868
Epigenetic Regulations of This DT (EGR)

Methylation

  Atypical teratoid rhabdoid tumor

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 5'UTR (cg01789267)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.25E+00 Statistic Test p-value: 1.15E-08; Z-score: -1.67E+00

Methylation in Case

 6.10E-01 (Median) Methylation in Control 7.59E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC28A2 in atypical teratoid rhabdoid tumor [ 1 ]

Location

 3'UTR (cg11105927)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.73E+00 Statistic Test p-value: 6.65E-12; Z-score: 1.84E+00

Methylation in Case

 3.10E-01 (Median) Methylation in Control 1.80E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Bladder cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in bladder cancer [ 2 ]

Location

 5'UTR (cg01789267)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 5.27E-04; Z-score: -2.73E+00

Methylation in Case

 8.71E-01 (Median) Methylation in Control 8.88E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC28A2 in bladder cancer [ 2 ]

Location

 TSS1500 (cg07222908)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.29E-02; Z-score: -1.95E+00

Methylation in Case

 6.95E-01 (Median) Methylation in Control 7.47E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC28A2 in bladder cancer [ 2 ]

Location

 3'UTR (cg11105927)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 3.26E-02; Z-score: -1.40E+00

Methylation in Case

 8.04E-01 (Median) Methylation in Control 8.30E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in breast cancer [ 3 ]

Location

 5'UTR (cg01789267)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 2.99E-02; Z-score: -5.91E-01

Methylation in Case

 8.28E-01 (Median) Methylation in Control 8.76E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in papillary thyroid cancer [ 4 ]

Location

 5'UTR (cg01789267)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.05E-02; Z-score: -5.60E-01

Methylation in Case

 9.10E-01 (Median) Methylation in Control 9.21E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC28A2 in papillary thyroid cancer [ 4 ]

Location

 TSS1500 (cg15395560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 4.28E-04; Z-score: -6.39E-01

Methylation in Case

 7.78E-01 (Median) Methylation in Control 8.07E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg16545196)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 3.94E-07; Z-score: -1.77E+00

Methylation in Case

 7.04E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC28A2 in colorectal cancer [ 5 ]

Location

 TSS1500 (cg15395560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.13E-02; Z-score: -6.99E-01

Methylation in Case

 8.66E-01 (Median) Methylation in Control 8.90E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC28A2 in colorectal cancer [ 5 ]

Location

 3'UTR (cg11105927)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 2.69E-15; Z-score: -3.13E+00

Methylation in Case

 8.73E-01 (Median) Methylation in Control 9.16E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg15395560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 1.74E-03; Z-score: -4.39E-01

Methylation in Case

 7.08E-01 (Median) Methylation in Control 7.27E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC28A2 in hepatocellular carcinoma [ 6 ]

Location

 TSS1500 (cg16545196)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.17E-02; Z-score: -4.26E-01

Methylation in Case

 6.61E-01 (Median) Methylation in Control 6.77E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC28A2 in hepatocellular carcinoma [ 6 ]

Location

 TSS200 (cg19305227)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.01E-02; Z-score: -2.58E-01

Methylation in Case

 8.26E-01 (Median) Methylation in Control 8.33E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC28A2 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg13519061)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 2.04E-14; Z-score: -2.18E+00

Methylation in Case

 5.98E-01 (Median) Methylation in Control 7.88E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC28A2 in hepatocellular carcinoma [ 6 ]

Location

 Body (cg18860310)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.30E+00 Statistic Test p-value: 1.97E-13; Z-score: -2.00E+00

Methylation in Case

 4.50E-01 (Median) Methylation in Control 5.87E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  HIV infection

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in HIV infection [ 7 ]

Location

 TSS1500 (cg15395560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 1.48E-03; Z-score: -1.72E+00

Methylation in Case

 7.16E-01 (Median) Methylation in Control 7.73E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC28A2 in HIV infection [ 7 ]

Location

 TSS200 (cg19305227)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.01E-03; Z-score: -8.22E-01

Methylation in Case

 8.92E-01 (Median) Methylation in Control 9.08E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in lung adenocarcinoma [ 8 ]

Location

 TSS1500 (cg15395560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.09E+00 Statistic Test p-value: 1.29E-02; Z-score: -1.69E+00

Methylation in Case

 6.64E-01 (Median) Methylation in Control 7.25E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC28A2 in lung adenocarcinoma [ 8 ]

Location

 TSS200 (cg19305227)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.74E-02; Z-score: -1.55E+00

Methylation in Case

 8.31E-01 (Median) Methylation in Control 8.66E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in systemic lupus erythematosus [ 9 ]

Location

 TSS1500 (cg07222908)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 1.25E-02; Z-score: -1.85E-01

Methylation in Case

 7.99E-01 (Median) Methylation in Control 8.05E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

  Pancretic ductal adenocarcinoma

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC28A2 in pancretic ductal adenocarcinoma [ 10 ]

Location

 Body (cg26583753)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 1.22E-02; Z-score: 8.10E-01

Methylation in Case

 8.73E-01 (Median) Methylation in Control 8.54E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

Histone acetylation

  Colorectal cancer

            3 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Hypoacetylation of SLC28A2 in colorectal cancer [ 11 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC28A2 Experiment Method Western Blot

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Multiple cell lines of human

Additional Notes

 Histone hypoacetylation due to increased levels of histone deacetylase 7 results in CNT2 repression in CRC tumour tissue and could lead to decreased uptake of and consequent resistance to nucleoside anti-cancer agents.

  Epigenetic Phenomenon 2

 Hypoacetylation of SLC28A2 in colorectal cancer [ 11 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC28A2 Experiment Method Western Blot

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Multiple cell lines of human

Additional Notes

 Histone hypoacetylation due to increased levels of histone deacetylase 7 results in CNT2 repression in CRC tumour tissue and could lead to decreased uptake of and consequent resistance to nucleoside anti-cancer agents.

  Epigenetic Phenomenon 3

 Hypoacetylation of SLC28A2 in colorectal cancer [ 11 ]

Location

 Promoter

Epigenetic Type

 Histone acetylation Experiment Method Chromatin immunoprecipitation

Related Molecular Changes

 Down regulation of SLC28A2 Experiment Method Western Blot

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Multiple cell lines of human

Additional Notes

 Histone hypoacetylation due to increased levels of histone deacetylase 7 results in CNT2 repression in CRC tumour tissue and could lead to decreased uptake of and consequent resistance to nucleoside anti-cancer agents.

microRNA

  Unclear Phenotype

          17 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-106a directly targets SLC28A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-106a miRNA Mature ID miR-106a-3p

miRNA Sequence

 CUGCAAUGUAAGCACUUCUUAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 2

 miR-122 directly targets SLC28A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-122 miRNA Mature ID miR-122-3p

miRNA Sequence

 AACGCCAUUAUCACACUAAAUA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 3

 miR-1281 directly targets SLC28A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1281 miRNA Mature ID miR-1281

miRNA Sequence

 UCGCCUCCUCCUCUCCC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 4

 miR-1976 directly targets SLC28A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-1976 miRNA Mature ID miR-1976

miRNA Sequence

 CCUCCUGCCCUCCUUGCUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 5

 miR-208a directly targets SLC28A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-208a miRNA Mature ID miR-208a-5p

miRNA Sequence

 GAGCUUUUGGCCCGGGUUAUAC

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 6

 miR-208b directly targets SLC28A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-208b miRNA Mature ID miR-208b-5p

miRNA Sequence

 AAGCUUUUUGCUCGAAUUAUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 7

 miR-3121 directly targets SLC28A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-3121 miRNA Mature ID miR-3121-5p

miRNA Sequence

 UCCUUUGCCUAUUCUAUUUAAG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 8

 miR-4279 directly targets SLC28A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4279 miRNA Mature ID miR-4279

miRNA Sequence

 CUCUCCUCCCGGCUUC

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 9

 miR-4485 directly targets SLC28A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4485 miRNA Mature ID miR-4485-5p

miRNA Sequence

 ACCGCCUGCCCAGUGA

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 10

 miR-450b directly targets SLC28A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-450b miRNA Mature ID miR-450b-5p

miRNA Sequence

 UUUUGCAAUAUGUUCCUGAAUA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 11

 miR-4705 directly targets SLC28A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4705 miRNA Mature ID miR-4705

miRNA Sequence

 UCAAUCACUUGGUAAUUGCUGU

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 12

 miR-4719 directly targets SLC28A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4719 miRNA Mature ID miR-4719

miRNA Sequence

 UCACAAAUCUAUAAUAUGCAGG

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)

  Epigenetic Phenomenon 13

 miR-4722 directly targets SLC28A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-4722 miRNA Mature ID miR-4722-3p

miRNA Sequence

 ACCUGCCAGCACCUCCCUGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 14

 miR-6727 directly targets SLC28A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6727 miRNA Mature ID miR-6727-3p

miRNA Sequence

 UCCUGCCACCUCCUCCGCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 15

 miR-6747 directly targets SLC28A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6747 miRNA Mature ID miR-6747-3p

miRNA Sequence

 UCCUGCCUUCCUCUGCACCAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 16

 miR-6778 directly targets SLC28A2 [ 13 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6778 miRNA Mature ID miR-6778-3p

miRNA Sequence

 UGCCUCCCUGACAUUCCACAG

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human

  Epigenetic Phenomenon 17

 miR-6782 directly targets SLC28A2 [ 12 ]

Epigenetic Type

 microRNA Experiment Method PAR-CLIP

miRNA Stemloop ID

 miR-6782 miRNA Mature ID miR-6782-3p

miRNA Sequence

 CACCUUUGUGUCCCCAUCCUGCA

miRNA Target Type

 Direct

Experimental Material

 Human embryonic kidney 293 cells (HEK293)
References
1 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
5 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
6 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
7 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
8 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
9 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
10 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
11 Inhibition of histone deacetylase 7 reverses concentrative nucleoside transporter 2 repression in colorectal cancer by up-regulating histone acetylation state. Br J Pharmacol. 2018 Nov;175(22):4209-4217.
12 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response. Genes Dev. 2011 Oct 15;25(20):2173-86.
13 The Landscape of microRNA Targeting in Prostate Cancer Defined by AGO-PAR-CLIP. Neoplasia. 2016 Jun;18(6):356-70.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.