Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0247 Transporter Info | ||||
Gene Name | SLC29A1 | ||||
Transporter Name | Equilibrative nucleoside transporter 1 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
73 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-1 directly targets SLC29A1 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Proteomics | ||
miRNA Stemloop ID |
miR-1 | miRNA Mature ID | miR-1-3p | ||
miRNA Sequence |
UGGAAUGUAAAGAAGUAUGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 2 |
miR-124 directly targets SLC29A1 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-124 | miRNA Mature ID | miR-124-3p | ||
miRNA Sequence |
UAAGGCACGCGGUGAAUGCCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human cervical cancer cell line (Hela) | ||||
Epigenetic Phenomenon 3 |
miR-1249 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1249 | miRNA Mature ID | miR-1249-5p | ||
miRNA Sequence |
AGGAGGGAGGAGAUGGGCCAAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-127 directly targets SLC29A1 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-127 | miRNA Mature ID | miR-127-3p | ||
miRNA Sequence |
UCGGAUCCGUCUGAGCUUGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Patient tissue samples | ||||
Epigenetic Phenomenon 5 |
miR-1277 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1277 | miRNA Mature ID | miR-1277-5p | ||
miRNA Sequence |
AAAUAUAUAUAUAUAUGUACGUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 6 |
miR-1321 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1321 | miRNA Mature ID | miR-1321 | ||
miRNA Sequence |
CAGGGAGGUGAAUGUGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 7 |
miR-1324 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1324 | miRNA Mature ID | miR-1324 | ||
miRNA Sequence |
CCAGACAGAAUUCUAUGCACUUUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-149 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-149 | miRNA Mature ID | miR-149-3p | ||
miRNA Sequence |
AGGGAGGGACGGGGGCUGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 9 |
miR-15a directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-15a | miRNA Mature ID | miR-15a-5p | ||
miRNA Sequence |
UAGCAGCACAUAAUGGUUUGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 10 |
miR-15b directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-15b | miRNA Mature ID | miR-15b-5p | ||
miRNA Sequence |
UAGCAGCACAUCAUGGUUUACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 11 |
miR-16 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-16 | miRNA Mature ID | miR-16-5p | ||
miRNA Sequence |
UAGCAGCACGUAAAUAUUGGCG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 12 |
miR-1827 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1827 | miRNA Mature ID | miR-1827 | ||
miRNA Sequence |
UGAGGCAGUAGAUUGAAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 13 |
miR-186 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-186 | miRNA Mature ID | miR-186-5p | ||
miRNA Sequence |
CAAAGAAUUCUCCUUUUGGGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 14 |
miR-1910 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1910 | miRNA Mature ID | miR-1910-3p | ||
miRNA Sequence |
GAGGCAGAAGCAGGAUGACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-1910 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-1910 | miRNA Mature ID | miR-1910-5p | ||
miRNA Sequence |
CCAGUCCUGUGCCUGCCGCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-195 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-195 | miRNA Mature ID | miR-195-5p | ||
miRNA Sequence |
UAGCAGCACAGAAAUAUUGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 17 |
miR-196a directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-196a | miRNA Mature ID | miR-196a-3p | ||
miRNA Sequence |
CGGCAACAAGAAACUGCCUGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 18 |
miR-202 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-202 | miRNA Mature ID | miR-202-5p | ||
miRNA Sequence |
UUCCUAUGCAUAUACUUCUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 19 |
miR-215 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-215 | miRNA Mature ID | miR-215-3p | ||
miRNA Sequence |
UCUGUCAUUUCUUUAGGCCAAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 20 |
miR-2682 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-2682 | miRNA Mature ID | miR-2682-5p | ||
miRNA Sequence |
CAGGCAGUGACUGUUCAGACGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 21 |
miR-3166 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3166 | miRNA Mature ID | miR-3166 | ||
miRNA Sequence |
CGCAGACAAUGCCUACUGGCCUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-328 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-328 | miRNA Mature ID | miR-328-5p | ||
miRNA Sequence |
GGGGGGGCAGGAGGGGCUCAGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 23 |
miR-34b directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-34b | miRNA Mature ID | miR-34b-5p | ||
miRNA Sequence |
UAGGCAGUGUCAUUAGCUGAUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 24 |
miR-3612 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3612 | miRNA Mature ID | miR-3612 | ||
miRNA Sequence |
AGGAGGCAUCUUGAGAAAUGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 25 |
miR-3671 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3671 | miRNA Mature ID | miR-3671 | ||
miRNA Sequence |
AUCAAAUAAGGACUAGUCUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 26 |
miR-3688 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3688 | miRNA Mature ID | miR-3688-5p | ||
miRNA Sequence |
AGUGGCAAAGUCUUUCCAUAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 27 |
miR-3714 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-3714 | miRNA Mature ID | miR-3714 | ||
miRNA Sequence |
GAAGGCAGCAGUGCUCCCCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 28 |
miR-424 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-424 | miRNA Mature ID | miR-424-5p | ||
miRNA Sequence |
CAGCAGCAAUUCAUGUUUUGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 29 |
miR-4270 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4270 | miRNA Mature ID | miR-4270 | ||
miRNA Sequence |
UCAGGGAGUCAGGGGAGGGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 30 |
miR-4441 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4441 | miRNA Mature ID | miR-4441 | ||
miRNA Sequence |
ACAGGGAGGAGAUUGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 31 |
miR-449c directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-449c | miRNA Mature ID | miR-449c-5p | ||
miRNA Sequence |
UAGGCAGUGUAUUGCUAGCGGCUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 32 |
miR-4510 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4510 | miRNA Mature ID | miR-4510 | ||
miRNA Sequence |
UGAGGGAGUAGGAUGUAUGGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 33 |
miR-4514 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4514 | miRNA Mature ID | miR-4514 | ||
miRNA Sequence |
ACAGGCAGGAUUGGGGAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 34 |
miR-4524b directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4524b | miRNA Mature ID | miR-4524b-3p | ||
miRNA Sequence |
GAGACAGGUUCAUGCUGCUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 35 |
miR-4667 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4667 | miRNA Mature ID | miR-4667-3p | ||
miRNA Sequence |
UCCCUCCUUCUGUCCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 36 |
miR-4688 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4688 | miRNA Mature ID | miR-4688 | ||
miRNA Sequence |
UAGGGGCAGCAGAGGACCUGGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 37 |
miR-4692 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4692 | miRNA Mature ID | miR-4692 | ||
miRNA Sequence |
UCAGGCAGUGUGGGUAUCAGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 38 |
miR-4695 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4695 | miRNA Mature ID | miR-4695-5p | ||
miRNA Sequence |
CAGGAGGCAGUGGGCGAGCAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 39 |
miR-4722 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4722 | miRNA Mature ID | miR-4722-5p | ||
miRNA Sequence |
GGCAGGAGGGCUGUGCCAGGUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 40 |
miR-4728 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4728 | miRNA Mature ID | miR-4728-5p | ||
miRNA Sequence |
UGGGAGGGGAGAGGCAGCAAGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 41 |
miR-4739 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4739 | miRNA Mature ID | miR-4739 | ||
miRNA Sequence |
AAGGGAGGAGGAGCGGAGGGGCCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 42 |
miR-4743 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4743 | miRNA Mature ID | miR-4743-3p | ||
miRNA Sequence |
UUUCUGUCUUUUCUGGUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 43 |
miR-4756 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-4756 | miRNA Mature ID | miR-4756-5p | ||
miRNA Sequence |
CAGGGAGGCGCUCACUCUCUGCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 44 |
miR-486 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-486 | miRNA Mature ID | miR-486-3p | ||
miRNA Sequence |
CGGGGCAGCUCAGUACAGGAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 45 |
miR-497 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-497 | miRNA Mature ID | miR-497-5p | ||
miRNA Sequence |
CAGCAGCACACUGUGGUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 46 |
miR-545 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-545 | miRNA Mature ID | miR-545-3p | ||
miRNA Sequence |
UCAGCAAACAUUUAUUGUGUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 47 |
miR-548ac directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548ac | miRNA Mature ID | miR-548ac | ||
miRNA Sequence |
CAAAAACCGGCAAUUACUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 48 |
miR-548an directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548an | miRNA Mature ID | miR-548an | ||
miRNA Sequence |
AAAAGGCAUUGUGGUUUUUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 49 |
miR-548as directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548as | miRNA Mature ID | miR-548as-3p | ||
miRNA Sequence |
UAAAACCCACAAUUAUGUUUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 50 |
miR-548bb directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548bb | miRNA Mature ID | miR-548bb-3p | ||
miRNA Sequence |
CAAAAACCAUAGUUACUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 51 |
miR-548d directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548d | miRNA Mature ID | miR-548d-3p | ||
miRNA Sequence |
CAAAAACCACAGUUUCUUUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 52 |
miR-548h directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548h | miRNA Mature ID | miR-548h-3p | ||
miRNA Sequence |
CAAAAACCGCAAUUACUUUUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 53 |
miR-548z directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-548z | miRNA Mature ID | miR-548z | ||
miRNA Sequence |
CAAAAACCGCAAUUACUUUUGCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 54 |
miR-6127 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6127 | miRNA Mature ID | miR-6127 | ||
miRNA Sequence |
UGAGGGAGUGGGUGGGAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 55 |
miR-6129 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6129 | miRNA Mature ID | miR-6129 | ||
miRNA Sequence |
UGAGGGAGUUGGGUGUAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 56 |
miR-6130 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6130 | miRNA Mature ID | miR-6130 | ||
miRNA Sequence |
UGAGGGAGUGGAUUGUAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 57 |
miR-6133 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6133 | miRNA Mature ID | miR-6133 | ||
miRNA Sequence |
UGAGGGAGGAGGUUGGGUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 58 |
miR-650 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-650 | miRNA Mature ID | miR-650 | ||
miRNA Sequence |
AGGAGGCAGCGCUCUCAGGAC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 59 |
miR-6511a directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6511a | miRNA Mature ID | miR-6511a-5p | ||
miRNA Sequence |
CAGGCAGAAGUGGGGCUGACAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 60 |
miR-6721 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6721 | miRNA Mature ID | miR-6721-5p | ||
miRNA Sequence |
UGGGCAGGGGCUUAUUGUAGGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 61 |
miR-6743 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6743 | miRNA Mature ID | miR-6743-5p | ||
miRNA Sequence |
AAGGGGCAGGGACGGGUGGCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 62 |
miR-6754 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6754 | miRNA Mature ID | miR-6754-5p | ||
miRNA Sequence |
CCAGGGAGGCUGGUUUGGAGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 63 |
miR-676 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-676 | miRNA Mature ID | miR-676-3p | ||
miRNA Sequence |
CUGUCCUAAGGUUGUUGAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 64 |
miR-6773 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6773 | miRNA Mature ID | miR-6773-3p | ||
miRNA Sequence |
ACUGUCACUUCUCUGCCCAUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 65 |
miR-6785 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6785 | miRNA Mature ID | miR-6785-5p | ||
miRNA Sequence |
UGGGAGGGCGUGGAUGAUGGUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 66 |
miR-6797 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6797 | miRNA Mature ID | miR-6797-5p | ||
miRNA Sequence |
AGGAGGGAAGGGGCUGAGAACAGGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 67 |
miR-6808 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6808 | miRNA Mature ID | miR-6808-5p | ||
miRNA Sequence |
CAGGCAGGGAGGUGGGACCAUG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 68 |
miR-6838 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6838 | miRNA Mature ID | miR-6838-5p | ||
miRNA Sequence |
AAGCAGCAGUGGCAAGACUCCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 69 |
miR-6883 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6883 | miRNA Mature ID | miR-6883-5p | ||
miRNA Sequence |
AGGGAGGGUGUGGUAUGGAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 70 |
miR-6888 directly targets SLC29A1 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6888 | miRNA Mature ID | miR-6888-3p | ||
miRNA Sequence |
AUCUGUCUCGAUUGUUUCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 71 |
miR-6893 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-6893 | miRNA Mature ID | miR-6893-5p | ||
miRNA Sequence |
CAGGCAGGUGUAGGGUGGAGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 72 |
miR-7845 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-7845 | miRNA Mature ID | miR-7845-5p | ||
miRNA Sequence |
AAGGGACAGGGAGGGUCGUGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 73 |
miR-940 directly targets SLC29A1 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
miRNA Stemloop ID |
miR-940 | miRNA Mature ID | miR-940 | ||
miRNA Sequence |
AAGGCAGGGCCCCCGCUCCCC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Human liver tissue |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
miR-95 regulates SLC29A1 expression | [ 6 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Taqman OpenArray Human miRNA Panel | ||
miRNA Stemloop ID |
miR-95 | miRNA Mature ID | miR-95-5p | ||
miRNA Sequence |
UCAAUAAAUGUCUGUUGAAUU | ||||
miRNA Target Type |
Undirect | ||||
Studied Phenotype |
Human liver tissue | ||||
Experimental Material |
Patient tissue samples | ||||
Additional Notes |
The effects of rifampin on four uptake drug transporters SLC29A1 were negatively correlated with the rifampin effects on miR-95 expression(r=-0.79, p=0.0048). | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.