Detail Information of Epigenetic Regulations

General Information of Drug Transporter (DT)
DT ID DTD0249 Transporter Info
Gene Name SLC29A3
Transporter Name Equilibrative nucleoside transporter 3
Gene ID
55315
UniProt ID
Q9BZD2
Epigenetic Regulations of This DT (EGR)

Methylation

  Pancretic ductal adenocarcinoma

            5 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg20890210)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 2.81E+00 Statistic Test p-value: 8.03E-14; Z-score: 2.63E+00

Methylation in Case

 3.82E-01 (Median) Methylation in Control 1.36E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 5'UTR (cg20597714)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.18E+00 Statistic Test p-value: 1.42E-02; Z-score: -7.64E-01

Methylation in Case

 3.07E-02 (Median) Methylation in Control 3.63E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 TSS1500 (cg01517431)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.08E+00 Statistic Test p-value: 2.00E-02; Z-score: -8.09E-01

Methylation in Case

 7.42E-01 (Median) Methylation in Control 7.99E-01 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 1stExon (cg17721710)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 1.16E-05; Z-score: 1.89E-01

Methylation in Case

 7.89E-02 (Median) Methylation in Control 7.52E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC29A3 in pancretic ductal adenocarcinoma [ 1 ]

Location

 Body (cg10208461)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.07E+00 Statistic Test p-value: 1.26E-02; Z-score: -3.51E-01

Methylation in Case

 9.07E-02 (Median) Methylation in Control 9.66E-02 (Median)

Studied Phenotype

 Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0]

Experimental Material

 Patient tissue samples

  Bladder cancer

          11 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg09378339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.24E+00 Statistic Test p-value: 1.57E-07; Z-score: -1.12E+01

Methylation in Case

 6.93E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg19241744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -2.17E+00 Statistic Test p-value: 9.26E-07; Z-score: -6.22E+00

Methylation in Case

 1.13E-01 (Median) Methylation in Control 2.45E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS1500 (cg05950509)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 9.88E-06; Z-score: -8.03E+00

Methylation in Case

 6.45E-01 (Median) Methylation in Control 7.66E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS200 (cg04402744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.66E+00 Statistic Test p-value: 2.23E-03; Z-score: -1.98E+00

Methylation in Case

 1.28E-02 (Median) Methylation in Control 2.12E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.24E+00 Statistic Test p-value: 9.56E-03; Z-score: 1.28E+00

Methylation in Case

 4.53E-02 (Median) Methylation in Control 3.65E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.97E+00 Statistic Test p-value: 6.02E-12; Z-score: -2.33E+01

Methylation in Case

 3.22E-01 (Median) Methylation in Control 6.36E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg08874645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.70E+00 Statistic Test p-value: 9.85E-09; Z-score: -6.95E+00

Methylation in Case

 3.30E-01 (Median) Methylation in Control 5.60E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 8

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.10E+00 Statistic Test p-value: 1.69E-05; Z-score: -4.29E+00

Methylation in Case

 7.85E-01 (Median) Methylation in Control 8.62E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 9

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg24631518)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 1.97E-03; Z-score: -4.10E+00

Methylation in Case

 8.67E-01 (Median) Methylation in Control 8.85E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 10

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg22704915)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.42E+00 Statistic Test p-value: 4.58E-03; Z-score: 1.95E+00

Methylation in Case

 5.58E-02 (Median) Methylation in Control 3.92E-02 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 11

 Methylation of SLC29A3 in bladder cancer [ 2 ]

Location

 Body (cg02114341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 3.80E-02; Z-score: -1.20E+00

Methylation in Case

 8.23E-01 (Median) Methylation in Control 8.44E-01 (Median)

Studied Phenotype

 Bladder cancer [ ICD-11: 2C94]

Experimental Material

 Patient tissue samples

  Breast cancer

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 TSS1500 (cg09378339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.03E+00 Statistic Test p-value: 4.30E-02; Z-score: 1.84E-01

Methylation in Case

 8.01E-01 (Median) Methylation in Control 7.76E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.59E+00 Statistic Test p-value: 4.06E-04; Z-score: 7.11E-01

Methylation in Case

 5.75E-02 (Median) Methylation in Control 3.62E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.17E+00 Statistic Test p-value: 1.26E-14; Z-score: -2.21E+00

Methylation in Case

 6.65E-01 (Median) Methylation in Control 7.78E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 Body (cg24631518)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.02E+00 Statistic Test p-value: 9.84E-07; Z-score: -1.07E+00

Methylation in Case

 8.44E-01 (Median) Methylation in Control 8.64E-01 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 Body (cg22704915)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.31E+00 Statistic Test p-value: 3.06E-02; Z-score: 2.43E-01

Methylation in Case

 3.98E-02 (Median) Methylation in Control 3.03E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC29A3 in breast cancer [ 3 ]

Location

 Body (cg01478450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.15E+00 Statistic Test p-value: 3.31E-02; Z-score: -6.19E-01

Methylation in Case

 6.35E-02 (Median) Methylation in Control 7.29E-02 (Median)

Studied Phenotype

 Breast cancer [ ICD-11: 2C60-2C6Z]

Experimental Material

 Patient tissue samples

  Renal cell carcinoma

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS1500 (cg19241744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 1.92E-07; Z-score: -3.54E+00

Methylation in Case

 3.45E-01 (Median) Methylation in Control 4.55E-01 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg23634459)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 7.94E-04; Z-score: -6.85E-01

Methylation in Case

 2.44E-02 (Median) Methylation in Control 2.91E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in clear cell renal cell carcinoma [ 4 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.11E+00 Statistic Test p-value: 1.49E-03; Z-score: 8.11E-01

Methylation in Case

 3.20E-02 (Median) Methylation in Control 2.89E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in clear cell renal cell carcinoma [ 4 ]

Location

 Body (cg01478450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.13E+00 Statistic Test p-value: 3.71E-03; Z-score: 6.02E-01

Methylation in Case

 2.77E-02 (Median) Methylation in Control 2.45E-02 (Median)

Studied Phenotype

 Renal cell carcinoma [ ICD-11: 2C90]

Experimental Material

 Patient tissue samples

  Colon cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg27645544)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.27E+00 Statistic Test p-value: 1.60E-04; Z-score: -1.74E+00

Methylation in Case

 4.64E-01 (Median) Methylation in Control 5.91E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in colon adenocarcinoma [ 5 ]

Location

 TSS1500 (cg23702688)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.33E+00 Statistic Test p-value: 2.65E-04; Z-score: -1.61E+00

Methylation in Case

 2.13E-01 (Median) Methylation in Control 2.84E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in colon adenocarcinoma [ 5 ]

Location

 TSS200 (cg22821560)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.32E+00 Statistic Test p-value: 5.91E-07; Z-score: -5.21E+00

Methylation in Case

 5.60E-01 (Median) Methylation in Control 7.41E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in colon adenocarcinoma [ 5 ]

Location

 Body (cg21156276)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.20E+00 Statistic Test p-value: 6.02E-04; Z-score: -1.19E+00

Methylation in Case

 3.70E-01 (Median) Methylation in Control 4.43E-01 (Median)

Studied Phenotype

 Colon cancer [ ICD-11: 2B90]

Experimental Material

 Patient tissue samples

  HIV infection

            6 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 TSS1500 (cg19241744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.19E-04; Z-score: -8.73E-01

Methylation in Case

 2.94E-01 (Median) Methylation in Control 3.35E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 TSS1500 (cg05950509)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 3.24E-03; Z-score: -1.21E+00

Methylation in Case

 8.30E-01 (Median) Methylation in Control 8.60E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 Body (cg23761815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 7.68E-21; Z-score: 3.21E+00

Methylation in Case

 9.05E-01 (Median) Methylation in Control 7.93E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 Body (cg08874645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.47E+00 Statistic Test p-value: 5.93E-08; Z-score: 2.90E+00

Methylation in Case

 4.16E-01 (Median) Methylation in Control 2.83E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.01E+00 Statistic Test p-value: 3.71E-03; Z-score: 7.14E-01

Methylation in Case

 9.32E-01 (Median) Methylation in Control 9.22E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC29A3 in HIV infection [ 6 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.14E+00 Statistic Test p-value: 3.20E-02; Z-score: 1.74E+00

Methylation in Case

 6.78E-01 (Median) Methylation in Control 5.92E-01 (Median)

Studied Phenotype

 HIV infection [ ICD-11: 1C62.Z]

Experimental Material

 Patient tissue samples

  Lung adenocarcinoma

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg19241744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.16E+00 Statistic Test p-value: 4.34E-02; Z-score: -1.67E+00

Methylation in Case

 3.20E-01 (Median) Methylation in Control 3.72E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in lung adenocarcinoma [ 7 ]

Location

 TSS1500 (cg05950509)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.06E+00 Statistic Test p-value: 4.87E-02; Z-score: -9.14E-01

Methylation in Case

 7.63E-01 (Median) Methylation in Control 8.09E-01 (Median)

Studied Phenotype

 Lung adenocarcinoma [ ICD-11: 2C25.0]

Experimental Material

 Patient tissue samples

  Papillary thyroid cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in papillary thyroid cancer [ 8 ]

Location

 TSS1500 (cg09378339)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 4.29E-02; Z-score: 1.34E+00

Methylation in Case

 8.63E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in papillary thyroid cancer [ 8 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.08E+00 Statistic Test p-value: 3.62E-02; Z-score: 6.62E-01

Methylation in Case

 9.25E-02 (Median) Methylation in Control 8.59E-02 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in papillary thyroid cancer [ 8 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 1.84E-08; Z-score: -1.73E+00

Methylation in Case

 8.90E-01 (Median) Methylation in Control 9.23E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in papillary thyroid cancer [ 8 ]

Location

 Body (cg06702884)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.10E+00 Statistic Test p-value: 6.08E-04; Z-score: 7.46E-01

Methylation in Case

 8.05E-01 (Median) Methylation in Control 7.32E-01 (Median)

Studied Phenotype

 Papillary thyroid cancer [ ICD-11: 2D10.1]

Experimental Material

 Patient tissue samples

  Hepatocellular carcinoma

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 TSS200 (cg06270147)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.25E+00 Statistic Test p-value: 9.29E-03; Z-score: 4.76E-01

Methylation in Case

 4.11E-02 (Median) Methylation in Control 3.30E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 TSS200 (cg04402744)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.02E+00 Statistic Test p-value: 9.94E-03; Z-score: 3.95E-02

Methylation in Case

 5.21E-02 (Median) Methylation in Control 5.12E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg06702884)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.04E+00 Statistic Test p-value: 2.43E-03; Z-score: -4.79E-01

Methylation in Case

 7.56E-01 (Median) Methylation in Control 7.84E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 3.87E-03; Z-score: -3.88E-01

Methylation in Case

 8.59E-01 (Median) Methylation in Control 8.65E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 Body (cg01478450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.05E+00 Statistic Test p-value: 4.79E-02; Z-score: -2.53E-01

Methylation in Case

 6.36E-02 (Median) Methylation in Control 6.66E-02 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 3'UTR (cg10366878)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.19E+00 Statistic Test p-value: 4.46E-10; Z-score: -2.54E+00

Methylation in Case

 6.33E-01 (Median) Methylation in Control 7.53E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC29A3 in hepatocellular carcinoma [ 9 ]

Location

 3'UTR (cg01442319)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.14E+00 Statistic Test p-value: 1.27E-09; Z-score: -3.04E+00

Methylation in Case

 7.24E-01 (Median) Methylation in Control 8.28E-01 (Median)

Studied Phenotype

 Hepatocellular carcinoma [ ICD-11: 2C12.02]

Experimental Material

 Patient tissue samples

  Atypical teratoid rhabdoid tumor

            7 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg01478450)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.03E+00 Statistic Test p-value: 7.00E-05; Z-score: -8.33E-01

Methylation in Case

 8.72E-01 (Median) Methylation in Control 9.00E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg02114341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 1.16E-04; Z-score: -8.83E-01

Methylation in Case

 7.03E-01 (Median) Methylation in Control 7.80E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.15E+00 Statistic Test p-value: 1.57E-04; Z-score: 8.85E-01

Methylation in Case

 8.71E-01 (Median) Methylation in Control 7.60E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg06702884)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.11E+00 Statistic Test p-value: 2.83E-03; Z-score: -6.18E-01

Methylation in Case

 6.69E-01 (Median) Methylation in Control 7.44E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 5

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg08874645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.04E+00 Statistic Test p-value: 8.56E-03; Z-score: 5.92E-01

Methylation in Case

 9.12E-01 (Median) Methylation in Control 8.80E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 6

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 Body (cg11480762)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 2.29E-02; Z-score: -6.53E-02

Methylation in Case

 6.11E-01 (Median) Methylation in Control 6.20E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 7

 Methylation of SLC29A3 in atypical teratoid rhabdoid tumor [ 10 ]

Location

 3'UTR (cg15937155)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.97E+00 Statistic Test p-value: 6.93E-11; Z-score: 1.92E+00

Methylation in Case

 2.26E-01 (Median) Methylation in Control 1.14E-01 (Median)

Studied Phenotype

 Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y]

Experimental Material

 Patient tissue samples

  Colorectal cancer

            4 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in colorectal cancer [ 11 ]

Location

 Body (cg23761815)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 5.68E-05; Z-score: -1.04E+00

Methylation in Case

 9.34E-01 (Median) Methylation in Control 9.44E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in colorectal cancer [ 11 ]

Location

 Body (cg22704915)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.29E+00 Statistic Test p-value: 5.99E-04; Z-score: 8.73E-01

Methylation in Case

 2.40E-02 (Median) Methylation in Control 1.86E-02 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 3

 Methylation of SLC29A3 in colorectal cancer [ 11 ]

Location

 Body (cg02354828)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 5.66E-03; Z-score: -5.40E-01

Methylation in Case

 9.49E-01 (Median) Methylation in Control 9.54E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 4

 Methylation of SLC29A3 in colorectal cancer [ 11 ]

Location

 Body (cg24631518)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.00E+00 Statistic Test p-value: 2.89E-02; Z-score: -2.67E-02

Methylation in Case

 9.38E-01 (Median) Methylation in Control 9.38E-01 (Median)

Studied Phenotype

 Colorectal cancer [ ICD-11: 2B91]

Experimental Material

 Patient tissue samples

  Panic disorder

            2 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in panic disorder [ 12 ]

Location

 Body (cg08874645)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -9.21E-01 Statistic Test p-value: 8.38E-03; Z-score: -4.77E-01

Methylation in Case

 -2.21E+00 (Median) Methylation in Control -2.04E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Epigenetic Phenomenon 2

 Methylation of SLC29A3 in panic disorder [ 12 ]

Location

 Body (cg17434453)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: 1.05E+00 Statistic Test p-value: 4.52E-02; Z-score: 4.63E-01

Methylation in Case

 2.71E+00 (Median) Methylation in Control 2.58E+00 (Median)

Studied Phenotype

 Panic disorder [ ICD-11: 6B01]

Experimental Material

 Patient tissue samples

  Prostate cancer

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in prostate cancer [ 13 ]

Location

 Body (cg21799607)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.52E+00 Statistic Test p-value: 9.20E-03; Z-score: -5.94E+00

Methylation in Case

 5.41E-01 (Median) Methylation in Control 8.25E-01 (Median)

Studied Phenotype

 Prostate cancer [ ICD-11: 2C82]

Experimental Material

 Patient tissue samples

  Systemic lupus erythematosus

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 Methylation of SLC29A3 in systemic lupus erythematosus [ 14 ]

Location

 Body (cg02114341)

Epigenetic Type

 Methylation Experiment Method Infinium HumanMethylation450 BeadChip

Methylation Fold Change

 Fold Change: -1.01E+00 Statistic Test p-value: 7.17E-03; Z-score: -1.12E-01

Methylation in Case

 8.43E-01 (Median) Methylation in Control 8.48E-01 (Median)

Studied Phenotype

 Systemic lupus erythematosus [ ICD-11: 4A40.0]

Experimental Material

 Patient tissue samples

microRNA

  Unclear Phenotype

            1 Epigenetic Phenomena Related to This Phenotype Click to Show/Hide the Full List

  Epigenetic Phenomenon 1

 miR-335 directly targets SLC29A3 [ 15 ]

Epigenetic Type

 microRNA Experiment Method Microarray

miRNA Stemloop ID

 miR-335 miRNA Mature ID miR-335-5p

miRNA Sequence

 UCAAGAGCAAUAACGAAAAAUGU

miRNA Target Type

 Direct

Experimental Material

 Multiple cell lines of human
References
1 Genome-wide DNA methylation patterns in pancreatic ductal adenocarcinoma reveal epigenetic deregulation of SLIT-ROBO, ITGA2 and MET signaling. Int J Cancer. 2014 Sep 1;135(5):1110-8.
2 DNA Methylation Dynamics in Urological Tumors.
3 Genome-wide Scan for Methylation Profiles in Breast Cancer
4 A CpG-methylation-based assay to predict survival in clear cell renal cell carcinoma. Nat Commun. 2015 Oct 30;6:8699.
5 Genome-scale analysis of DNA methylation in colorectal cancer using Infinium HumanMethylation450 BeadChips. Epigenetics. 2013 Sep;8(9):921-34.
6 HIV-1 Infection Accelerates Age According to the Epigenetic Clock. J Infect Dis. 2015 Nov 15;212(10):1563-73.
7 DNA methylation analysis of lung adenocarcinoma and adjacent non-tumor tissues
8 Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors. J Clin Endocrinol Metab. 2017 Nov 1;102(11):4089-4099.
9 Exploring genome-wide DNA methylation profiles altered in hepatocellular carcinoma using Infinium HumanMethylation 450 BeadChips. Epigenetics. 2013 Jan;8(1):34-43.
10 Atypical Teratoid/Rhabdoid Tumors Are Comprised of Three Epigenetic Subgroups with Distinct Enhancer Landscapes. Cancer Cell. 2016 Mar 14;29(3):379-393.
11 Differences in DNA methylation signatures reveal multiple pathways of progression from adenoma to colorectal cancer. Gastroenterology. 2014 Aug;147(2):418-29.e8.
12 DNA Methylation signatures in panic disorder. Transl Psychiatry. 2017 Dec 18;7(12):1287.
13 Reducing the risk of false discovery enabling identification of biologically significant genome-wide methylation status using the HumanMethylation450 array. BMC Genomics. 2014 Jan 22;15:51.
14 Genome-wide DNA methylation analysis of systemic lupus erythematosus reveals persistent hypomethylation of interferon genes and compositional changes to CD4+ T-cell populations. PLoS Genet. 2013;9(8):e1003678.
15 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.

If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.