Detail Information of Epigenetic Regulations
| General Information of Drug Transporter (DT) | |||||
|---|---|---|---|---|---|
| DT ID | DTD0251 Transporter Info | ||||
| Gene Name | SLC2A1 | ||||
| Transporter Name | Glucose transporter type 1, erythrocyte/brain | ||||
| Gene ID | |||||
| UniProt ID | |||||
| Epigenetic Regulations of This DT (EGR) | |||||
|---|---|---|---|---|---|
|
Methylation |
|||||
|
Depression |
2 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypermethylation of SLC2A1 in depressive disorder | [ 1 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Bisulfite sequencing | ||
|
Related Molecular Changes |
Down regulation of SLC2A1 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
The methylation level of the GLUT1 significantly increased in depressed inpatients compared to healthy comparison subjects. | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in depression | [ 13 ] | |||
|
Location |
Body (cg03128534) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 4.38E-02; Z-score: -2.72E-01 | ||
|
Methylation in Case |
3.45E-02 (Median) | Methylation in Control | 3.67E-02 (Median) | ||
|
Studied Phenotype |
Depression [ ICD-11: 6A8Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colon cancer |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg05663573) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.12E+00 | Statistic Test | p-value: 3.57E-08; Z-score: 3.98E+00 | ||
|
Methylation in Case |
5.40E-01 (Median) | Methylation in Control | 2.54E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
5'UTR (cg11964564) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.75E+00 | Statistic Test | p-value: 3.76E-03; Z-score: 1.85E+00 | ||
|
Methylation in Case |
3.34E-01 (Median) | Methylation in Control | 1.91E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg00095976) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.51E+00 | Statistic Test | p-value: 6.47E-06; Z-score: 8.00E+00 | ||
|
Methylation in Case |
3.95E-01 (Median) | Methylation in Control | 1.57E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
TSS1500 (cg11455040) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 2.73E-03; Z-score: -1.03E+00 | ||
|
Methylation in Case |
1.17E-01 (Median) | Methylation in Control | 1.39E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg09410234) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.17E+00 | Statistic Test | p-value: 2.13E-09; Z-score: 2.91E+00 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 2.53E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
TSS200 (cg09408768) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 1.28E-03; Z-score: 2.79E+00 | ||
|
Methylation in Case |
2.81E-01 (Median) | Methylation in Control | 1.93E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg23491790) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 4.84E-09; Z-score: 2.32E+00 | ||
|
Methylation in Case |
9.09E-01 (Median) | Methylation in Control | 8.34E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg01372572) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 1.38E-06; Z-score: -3.43E+00 | ||
|
Methylation in Case |
4.66E-01 (Median) | Methylation in Control | 6.30E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg13915754) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.66E+00 | Statistic Test | p-value: 2.07E-06; Z-score: 3.86E+00 | ||
|
Methylation in Case |
4.56E-01 (Median) | Methylation in Control | 1.71E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in colon adenocarcinoma | [ 2 ] | |||
|
Location |
Body (cg11015241) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.36E-05; Z-score: -3.98E+00 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.83E-01 (Median) | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Hepatocellular carcinoma |
23 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
5'UTR (cg03256780) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 1.65E-12; Z-score: -1.52E+00 | ||
|
Methylation in Case |
1.52E-01 (Median) | Methylation in Control | 2.35E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg19779211) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.23E+00 | Statistic Test | p-value: 1.93E-19; Z-score: 7.00E+00 | ||
|
Methylation in Case |
5.41E-01 (Median) | Methylation in Control | 2.43E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg21575465) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 3.44E-10; Z-score: -2.61E+00 | ||
|
Methylation in Case |
6.09E-01 (Median) | Methylation in Control | 7.53E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS1500 (cg09824328) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.24E+00 | Statistic Test | p-value: 1.17E-03; Z-score: 5.13E-01 | ||
|
Methylation in Case |
1.47E-01 (Median) | Methylation in Control | 1.18E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg02772823) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.47E+00 | Statistic Test | p-value: 4.81E-12; Z-score: -2.15E+00 | ||
|
Methylation in Case |
3.01E-01 (Median) | Methylation in Control | 4.42E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg01907688) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.07E-02; Z-score: 1.70E-02 | ||
|
Methylation in Case |
3.77E-02 (Median) | Methylation in Control | 3.74E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
TSS200 (cg26681016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.78E-02; Z-score: 2.43E-01 | ||
|
Methylation in Case |
6.51E-02 (Median) | Methylation in Control | 6.05E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg23221540) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 1.80E-21; Z-score: 2.24E+00 | ||
|
Methylation in Case |
8.40E-01 (Median) | Methylation in Control | 7.78E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg22198397) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.65E+00 | Statistic Test | p-value: 1.40E-20; Z-score: -4.21E+00 | ||
|
Methylation in Case |
4.18E-01 (Median) | Methylation in Control | 6.91E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg13492826) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.43E+00 | Statistic Test | p-value: 2.44E-18; Z-score: -3.38E+00 | ||
|
Methylation in Case |
4.59E-01 (Median) | Methylation in Control | 6.58E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg20698037) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.47E+00 | Statistic Test | p-value: 6.23E-18; Z-score: -1.27E+01 | ||
|
Methylation in Case |
5.79E-01 (Median) | Methylation in Control | 8.52E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg06228648) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 3.67E-12; Z-score: -2.83E+00 | ||
|
Methylation in Case |
5.91E-01 (Median) | Methylation in Control | 7.89E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg04287330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.98E+00 | Statistic Test | p-value: 8.25E-06; Z-score: 1.65E+00 | ||
|
Methylation in Case |
2.14E-01 (Median) | Methylation in Control | 1.08E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg20294984) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.82E-05; Z-score: -7.92E-01 | ||
|
Methylation in Case |
8.76E-01 (Median) | Methylation in Control | 8.92E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg22025263) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 5.19E-05; Z-score: -2.18E+00 | ||
|
Methylation in Case |
8.27E-01 (Median) | Methylation in Control | 8.57E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 2.81E-04; Z-score: -8.87E-01 | ||
|
Methylation in Case |
6.88E-01 (Median) | Methylation in Control | 7.39E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg21474257) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.31E-04; Z-score: -6.92E-01 | ||
|
Methylation in Case |
8.14E-01 (Median) | Methylation in Control | 8.27E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg06094523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 1.06E-03; Z-score: 5.48E-01 | ||
|
Methylation in Case |
5.07E-01 (Median) | Methylation in Control | 4.77E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg16738646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 2.63E-03; Z-score: 1.11E+00 | ||
|
Methylation in Case |
6.43E-01 (Median) | Methylation in Control | 5.80E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 20 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg26188818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.30E+00 | Statistic Test | p-value: 7.37E-03; Z-score: 3.41E-01 | ||
|
Methylation in Case |
1.37E-01 (Median) | Methylation in Control | 1.05E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 21 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg00737593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 2.26E-02; Z-score: 2.29E-01 | ||
|
Methylation in Case |
7.88E-01 (Median) | Methylation in Control | 7.73E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 22 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
Body (cg21877974) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.70E-02; Z-score: 1.09E-01 | ||
|
Methylation in Case |
2.19E-02 (Median) | Methylation in Control | 2.07E-02 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 23 |
Methylation of SLC2A1 in hepatocellular carcinoma | [ 3 ] | |||
|
Location |
3'UTR (cg26185836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 5.89E-07; Z-score: -2.69E+00 | ||
|
Methylation in Case |
8.11E-01 (Median) | Methylation in Control | 8.60E-01 (Median) | ||
|
Studied Phenotype |
Hepatocellular carcinoma [ ICD-11: 2C12.02] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Pancretic ductal adenocarcinoma |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
5'UTR (cg14686012) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.87E+00 | Statistic Test | p-value: 2.08E-32; Z-score: 9.96E+00 | ||
|
Methylation in Case |
2.64E-01 (Median) | Methylation in Control | 9.19E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg03929977) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 4.05E+00 | Statistic Test | p-value: 3.00E-30; Z-score: 4.94E+00 | ||
|
Methylation in Case |
3.77E-01 (Median) | Methylation in Control | 9.32E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg19065831) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 2.23E+00 | Statistic Test | p-value: 1.50E-23; Z-score: 4.24E+00 | ||
|
Methylation in Case |
3.58E-01 (Median) | Methylation in Control | 1.61E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg26001902) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.52E+00 | Statistic Test | p-value: 4.84E-03; Z-score: 5.31E-01 | ||
|
Methylation in Case |
1.75E-01 (Median) | Methylation in Control | 1.15E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
TSS200 (cg25725890) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.94E-02; Z-score: -5.49E-02 | ||
|
Methylation in Case |
9.36E-02 (Median) | Methylation in Control | 9.45E-02 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
1stExon (cg17793621) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.83E+00 | Statistic Test | p-value: 1.80E-08; Z-score: 2.13E+00 | ||
|
Methylation in Case |
3.75E-01 (Median) | Methylation in Control | 2.05E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg10017105) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 1.07E-03; Z-score: 9.22E-01 | ||
|
Methylation in Case |
7.35E-01 (Median) | Methylation in Control | 6.64E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg23048399) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 1.11E-02; Z-score: -1.28E+00 | ||
|
Methylation in Case |
1.96E-01 (Median) | Methylation in Control | 2.50E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg00757413) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 1.54E-02; Z-score: -4.58E-01 | ||
|
Methylation in Case |
9.04E-02 (Median) | Methylation in Control | 1.01E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg10246871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 2.11E-02; Z-score: 7.70E-01 | ||
|
Methylation in Case |
8.29E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
Body (cg14463790) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 2.50E-02; Z-score: 7.17E-01 | ||
|
Methylation in Case |
7.15E-01 (Median) | Methylation in Control | 6.62E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC2A1 in pancretic ductal adenocarcinoma | [ 4 ] | |||
|
Location |
3'UTR (cg02367856) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 3.76E-02; Z-score: 1.08E+00 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 7.33E-01 (Median) | ||
|
Studied Phenotype |
Pancretic ductal adenocarcinoma [ ICD-11: 2C10.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Prostate cancer |
9 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in prostate cancer | [ 5 ] | |||
|
Location |
5'UTR (cg04682775) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.43E+00 | Statistic Test | p-value: 1.33E-03; Z-score: -4.77E+00 | ||
|
Methylation in Case |
3.92E-01 (Median) | Methylation in Control | 5.61E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in prostate cancer | [ 5 ] | |||
|
Location |
5'UTR (cg17723122) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.75E+00 | Statistic Test | p-value: 3.90E-03; Z-score: -3.33E+00 | ||
|
Methylation in Case |
2.61E-01 (Median) | Methylation in Control | 4.59E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in prostate cancer | [ 5 ] | |||
|
Location |
TSS1500 (cg13980799) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.56E+00 | Statistic Test | p-value: 1.04E-02; Z-score: 2.54E+00 | ||
|
Methylation in Case |
8.19E-01 (Median) | Methylation in Control | 5.25E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in prostate cancer | [ 5 ] | |||
|
Location |
Body (cg10246871) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 4.21E-03; Z-score: 2.83E+00 | ||
|
Methylation in Case |
9.25E-01 (Median) | Methylation in Control | 8.65E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in prostate cancer | [ 5 ] | |||
|
Location |
Body (cg04486885) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 4.46E-03; Z-score: 2.55E+00 | ||
|
Methylation in Case |
7.89E-01 (Median) | Methylation in Control | 6.98E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in prostate cancer | [ 5 ] | |||
|
Location |
Body (cg04794858) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.19E-02; Z-score: 2.60E+00 | ||
|
Methylation in Case |
9.15E-01 (Median) | Methylation in Control | 8.78E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in prostate cancer | [ 5 ] | |||
|
Location |
Body (cg17409393) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.45E+00 | Statistic Test | p-value: 1.63E-02; Z-score: 2.45E+00 | ||
|
Methylation in Case |
8.65E-02 (Median) | Methylation in Control | 5.95E-02 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in prostate cancer | [ 5 ] | |||
|
Location |
Body (cg15572436) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.55E+00 | Statistic Test | p-value: 2.52E-02; Z-score: 4.06E+00 | ||
|
Methylation in Case |
6.22E-01 (Median) | Methylation in Control | 4.02E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in prostate cancer | [ 5 ] | |||
|
Location |
Body (cg03861217) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 4.31E-02; Z-score: 1.28E+00 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 8.06E-01 (Median) | ||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Bladder cancer |
15 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
TSS1500 (cg12101479) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.38E-06; Z-score: -1.50E+01 | ||
|
Methylation in Case |
7.74E-01 (Median) | Methylation in Control | 8.56E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg20282814) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.13E+00 | Statistic Test | p-value: 1.33E-11; Z-score: -1.08E+01 | ||
|
Methylation in Case |
2.27E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg00737593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.96E+00 | Statistic Test | p-value: 8.42E-10; Z-score: -1.20E+01 | ||
|
Methylation in Case |
3.88E-01 (Median) | Methylation in Control | 7.59E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg16738646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.01E+00 | Statistic Test | p-value: 1.31E-08; Z-score: -7.77E+00 | ||
|
Methylation in Case |
1.87E-01 (Median) | Methylation in Control | 5.64E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.84E+00 | Statistic Test | p-value: 7.54E-08; Z-score: -7.61E+00 | ||
|
Methylation in Case |
1.93E-01 (Median) | Methylation in Control | 5.48E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg05802386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -3.28E+00 | Statistic Test | p-value: 1.16E-07; Z-score: -7.49E+00 | ||
|
Methylation in Case |
1.98E-01 (Median) | Methylation in Control | 6.50E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg15089806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 5.83E-07; Z-score: -5.52E+00 | ||
|
Methylation in Case |
4.20E-01 (Median) | Methylation in Control | 6.73E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg09502149) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -2.49E+00 | Statistic Test | p-value: 1.40E-06; Z-score: -6.14E+00 | ||
|
Methylation in Case |
1.76E-01 (Median) | Methylation in Control | 4.38E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg06094523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.55E+00 | Statistic Test | p-value: 1.72E-05; Z-score: -4.66E+00 | ||
|
Methylation in Case |
2.68E-01 (Median) | Methylation in Control | 4.16E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg22025263) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.57E-03; Z-score: -2.43E+00 | ||
|
Methylation in Case |
6.72E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg21474257) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 1.67E-03; Z-score: -2.10E+00 | ||
|
Methylation in Case |
7.39E-01 (Median) | Methylation in Control | 8.09E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg05034603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 4.39E-03; Z-score: -2.34E+00 | ||
|
Methylation in Case |
3.72E-01 (Median) | Methylation in Control | 4.61E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg01924561) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 5.08E-03; Z-score: -1.87E+00 | ||
|
Methylation in Case |
7.59E-01 (Median) | Methylation in Control | 8.29E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
Body (cg26188818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.13E+00 | Statistic Test | p-value: 2.18E-02; Z-score: -1.21E+00 | ||
|
Methylation in Case |
7.68E-02 (Median) | Methylation in Control | 8.69E-02 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC2A1 in bladder cancer | [ 6 ] | |||
|
Location |
3'UTR (cg26185836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 2.51E-03; Z-score: -2.90E+00 | ||
|
Methylation in Case |
7.26E-01 (Median) | Methylation in Control | 7.66E-01 (Median) | ||
|
Studied Phenotype |
Bladder cancer [ ICD-11: 2C94] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Breast cancer |
19 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg12656391) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.46E+00 | Statistic Test | p-value: 9.24E-08; Z-score: 1.87E+00 | ||
|
Methylation in Case |
9.54E-02 (Median) | Methylation in Control | 6.54E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg12101479) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 1.32E-07; Z-score: -1.46E+00 | ||
|
Methylation in Case |
7.93E-01 (Median) | Methylation in Control | 8.43E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg09824328) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.79E+00 | Statistic Test | p-value: 5.98E-03; Z-score: 6.01E-01 | ||
|
Methylation in Case |
8.83E-02 (Median) | Methylation in Control | 4.93E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
TSS1500 (cg00102166) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 4.96E-02; Z-score: 3.59E-01 | ||
|
Methylation in Case |
1.55E-01 (Median) | Methylation in Control | 1.41E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg06094523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.31E+00 | Statistic Test | p-value: 3.67E-20; Z-score: -2.55E+00 | ||
|
Methylation in Case |
3.86E-01 (Median) | Methylation in Control | 5.08E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg00737593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.34E+00 | Statistic Test | p-value: 1.36E-19; Z-score: -3.48E+00 | ||
|
Methylation in Case |
5.81E-01 (Median) | Methylation in Control | 7.81E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg05802386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.60E+00 | Statistic Test | p-value: 3.53E-19; Z-score: -2.87E+00 | ||
|
Methylation in Case |
4.00E-01 (Median) | Methylation in Control | 6.38E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg16738646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 5.53E-14; Z-score: -1.86E+00 | ||
|
Methylation in Case |
3.82E-01 (Median) | Methylation in Control | 5.07E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg20282814) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.41E+00 | Statistic Test | p-value: 2.34E-13; Z-score: -2.06E+00 | ||
|
Methylation in Case |
4.54E-01 (Median) | Methylation in Control | 6.41E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg01924561) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 5.02E-12; Z-score: -2.82E+00 | ||
|
Methylation in Case |
5.33E-01 (Median) | Methylation in Control | 7.10E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg15089806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 2.06E-10; Z-score: -1.74E+00 | ||
|
Methylation in Case |
5.56E-01 (Median) | Methylation in Control | 6.60E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg05034603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.24E+00 | Statistic Test | p-value: 2.00E-08; Z-score: -2.40E+00 | ||
|
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 5.17E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg21474257) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 7.92E-08; Z-score: -1.48E+00 | ||
|
Methylation in Case |
7.84E-01 (Median) | Methylation in Control | 8.32E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 2.03E-05; Z-score: -1.29E+00 | ||
|
Methylation in Case |
4.76E-01 (Median) | Methylation in Control | 5.86E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg04287330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 1.65E-02; Z-score: -3.45E-01 | ||
|
Methylation in Case |
4.04E-02 (Median) | Methylation in Control | 4.49E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg26188818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 2.81E-02; Z-score: -3.53E-01 | ||
|
Methylation in Case |
6.61E-02 (Median) | Methylation in Control | 7.31E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg07499643) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 3.63E-02; Z-score: 7.08E-01 | ||
|
Methylation in Case |
1.71E-02 (Median) | Methylation in Control | 1.28E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 18 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg03128534) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 4.18E-02; Z-score: 2.44E-01 | ||
|
Methylation in Case |
1.16E-02 (Median) | Methylation in Control | 1.04E-02 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 19 |
Methylation of SLC2A1 in breast cancer | [ 7 ] | |||
|
Location |
Body (cg22025263) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 4.42E-02; Z-score: 8.69E-02 | ||
|
Methylation in Case |
7.45E-01 (Median) | Methylation in Control | 7.40E-01 (Median) | ||
|
Studied Phenotype |
Breast cancer [ ICD-11: 2C60-2C6Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Renal cell carcinoma |
11 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg12101479) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 1.86E-06; Z-score: -3.15E+00 | ||
|
Methylation in Case |
8.81E-01 (Median) | Methylation in Control | 9.26E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg12656391) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.74E+00 | Statistic Test | p-value: 8.52E-06; Z-score: 1.82E+00 | ||
|
Methylation in Case |
4.81E-02 (Median) | Methylation in Control | 2.76E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg09824328) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.29E+00 | Statistic Test | p-value: 6.05E-05; Z-score: 1.60E+00 | ||
|
Methylation in Case |
4.84E-02 (Median) | Methylation in Control | 3.75E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
TSS1500 (cg00102166) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.22E+00 | Statistic Test | p-value: 2.62E-02; Z-score: 4.60E-01 | ||
|
Methylation in Case |
9.74E-02 (Median) | Methylation in Control | 7.96E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
TSS200 (cg06792911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 8.52E-03; Z-score: 4.06E-01 | ||
|
Methylation in Case |
1.08E-02 (Median) | Methylation in Control | 9.86E-03 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
Body (cg00737593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 4.10E-14; Z-score: -7.83E+00 | ||
|
Methylation in Case |
5.97E-01 (Median) | Methylation in Control | 8.73E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
Body (cg05802386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.53E+00 | Statistic Test | p-value: 3.61E-13; Z-score: -6.35E+00 | ||
|
Methylation in Case |
4.92E-01 (Median) | Methylation in Control | 7.54E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
Body (cg20282814) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 2.12E-10; Z-score: -4.05E+00 | ||
|
Methylation in Case |
5.84E-01 (Median) | Methylation in Control | 7.86E-01 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
Body (cg04287330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.46E+00 | Statistic Test | p-value: 1.13E-06; Z-score: -9.92E-01 | ||
|
Methylation in Case |
1.37E-02 (Median) | Methylation in Control | 2.00E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
Body (cg07499643) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.05E+00 | Statistic Test | p-value: 1.88E-02; Z-score: 3.99E-01 | ||
|
Methylation in Case |
1.57E-02 (Median) | Methylation in Control | 1.50E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC2A1 in clear cell renal cell carcinoma | [ 8 ] | |||
|
Location |
Body (cg21877974) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 4.52E-02; Z-score: 1.62E-01 | ||
|
Methylation in Case |
1.52E-02 (Median) | Methylation in Control | 1.50E-02 (Median) | ||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Colorectal cancer |
18 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg00102166) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 8.84E-04; Z-score: 4.79E-01 | ||
|
Methylation in Case |
2.80E-01 (Median) | Methylation in Control | 2.57E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg09824328) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 4.73E-03; Z-score: 1.95E-01 | ||
|
Methylation in Case |
1.12E-01 (Median) | Methylation in Control | 1.04E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg12656391) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.12E+00 | Statistic Test | p-value: 1.81E-02; Z-score: 5.17E-01 | ||
|
Methylation in Case |
1.63E-01 (Median) | Methylation in Control | 1.45E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
TSS1500 (cg12101479) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 1.87E-02; Z-score: 3.04E-01 | ||
|
Methylation in Case |
9.04E-01 (Median) | Methylation in Control | 8.97E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
TSS200 (cg26681016) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 2.84E-03; Z-score: 9.23E-01 | ||
|
Methylation in Case |
6.73E-02 (Median) | Methylation in Control | 6.14E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg09502149) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.54E+00 | Statistic Test | p-value: 1.22E-09; Z-score: -2.15E+00 | ||
|
Methylation in Case |
4.93E-01 (Median) | Methylation in Control | 7.61E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg01924561) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 5.32E-09; Z-score: -2.30E+00 | ||
|
Methylation in Case |
8.28E-01 (Median) | Methylation in Control | 9.10E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg00737593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.10E+00 | Statistic Test | p-value: 4.31E-07; Z-score: -2.29E+00 | ||
|
Methylation in Case |
7.81E-01 (Median) | Methylation in Control | 8.62E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 1.08E-05; Z-score: -1.18E+00 | ||
|
Methylation in Case |
5.69E-01 (Median) | Methylation in Control | 6.72E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg05034603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.06E+00 | Statistic Test | p-value: 3.48E-04; Z-score: -6.75E-01 | ||
|
Methylation in Case |
6.14E-01 (Median) | Methylation in Control | 6.48E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg06094523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.11E+00 | Statistic Test | p-value: 3.77E-04; Z-score: -7.29E-01 | ||
|
Methylation in Case |
5.49E-01 (Median) | Methylation in Control | 6.11E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg20294984) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 4.62E-03; Z-score: -4.85E-01 | ||
|
Methylation in Case |
9.44E-01 (Median) | Methylation in Control | 9.49E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg21474257) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 7.42E-03; Z-score: -7.66E-01 | ||
|
Methylation in Case |
9.03E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg05345039) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 1.26E-02; Z-score: -7.05E-01 | ||
|
Methylation in Case |
9.31E-01 (Median) | Methylation in Control | 9.40E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
Body (cg03128534) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.17E+00 | Statistic Test | p-value: 4.27E-02; Z-score: -3.65E-01 | ||
|
Methylation in Case |
2.75E-02 (Median) | Methylation in Control | 3.23E-02 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC2A1 in colorectal cancer | [ 9 ] | |||
|
Location |
3'UTR (cg26185836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 1.33E-02; Z-score: -6.29E-01 | ||
|
Methylation in Case |
9.04E-01 (Median) | Methylation in Control | 9.20E-01 (Median) | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 17 |
Hypomethylation of SLC2A1 in colorectal cancer | [ 23 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Reduced representation bisulfite sequencing | ||
|
Studied Phenotype |
Colorectal cancer [ ICD-11: 2B91] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
Lower level methylation of SLC2A1 in colorectal cancer. | ||||
|
HIV infection |
16 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg12656391) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.41E+00 | Statistic Test | p-value: 7.14E-06; Z-score: 1.33E+00 | ||
|
Methylation in Case |
2.27E-01 (Median) | Methylation in Control | 1.62E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg09824328) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.62E+00 | Statistic Test | p-value: 4.75E-04; Z-score: 1.36E+00 | ||
|
Methylation in Case |
3.14E-01 (Median) | Methylation in Control | 1.93E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
TSS1500 (cg00102166) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.34E+00 | Statistic Test | p-value: 8.60E-04; Z-score: 9.06E-01 | ||
|
Methylation in Case |
3.09E-01 (Median) | Methylation in Control | 2.31E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
TSS200 (cg06792911) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.31E+00 | Statistic Test | p-value: 5.40E-04; Z-score: 1.31E+00 | ||
|
Methylation in Case |
5.67E-02 (Median) | Methylation in Control | 4.32E-02 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg06094523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.45E+00 | Statistic Test | p-value: 3.62E-13; Z-score: -2.26E+00 | ||
|
Methylation in Case |
1.31E-01 (Median) | Methylation in Control | 1.91E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg15089806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.27E+00 | Statistic Test | p-value: 3.69E-09; Z-score: -3.10E+00 | ||
|
Methylation in Case |
5.20E-01 (Median) | Methylation in Control | 6.58E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg20282814) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 5.92E-07; Z-score: -2.79E+00 | ||
|
Methylation in Case |
6.89E-01 (Median) | Methylation in Control | 8.11E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg16738646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.58E+00 | Statistic Test | p-value: 6.17E-07; Z-score: 1.99E+00 | ||
|
Methylation in Case |
3.97E-01 (Median) | Methylation in Control | 2.51E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg05802386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.20E+00 | Statistic Test | p-value: 7.71E-07; Z-score: -2.95E+00 | ||
|
Methylation in Case |
6.62E-01 (Median) | Methylation in Control | 7.94E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg00737593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 3.45E-06; Z-score: -2.77E+00 | ||
|
Methylation in Case |
7.23E-01 (Median) | Methylation in Control | 8.41E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg01924561) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 4.45E-05; Z-score: -1.21E+00 | ||
|
Methylation in Case |
5.40E-01 (Median) | Methylation in Control | 6.23E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg05034603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 1.71E-04; Z-score: -1.19E+00 | ||
|
Methylation in Case |
1.74E-01 (Median) | Methylation in Control | 2.13E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg21474257) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 4.69E-04; Z-score: -1.13E+00 | ||
|
Methylation in Case |
8.97E-01 (Median) | Methylation in Control | 9.13E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 14 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg09502149) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 3.71E-03; Z-score: -9.37E-01 | ||
|
Methylation in Case |
4.89E-01 (Median) | Methylation in Control | 5.25E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 15 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.07E+00 | Statistic Test | p-value: 8.03E-03; Z-score: -8.41E-01 | ||
|
Methylation in Case |
6.54E-01 (Median) | Methylation in Control | 7.01E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 16 |
Methylation of SLC2A1 in HIV infection | [ 10 ] | |||
|
Location |
Body (cg05345039) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.01E+00 | Statistic Test | p-value: 2.59E-02; Z-score: 4.97E-01 | ||
|
Methylation in Case |
9.37E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
HIV infection [ ICD-11: 1C62.Z] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Systemic lupus erythematosus |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
TSS1500 (cg09824328) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.15E+00 | Statistic Test | p-value: 6.10E-03; Z-score: 2.89E-01 | ||
|
Methylation in Case |
2.12E-01 (Median) | Methylation in Control | 1.84E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg04287330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 6.37E-03; Z-score: -1.65E-01 | ||
|
Methylation in Case |
5.33E-02 (Median) | Methylation in Control | 5.52E-02 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 6.60E-03; Z-score: -2.21E-01 | ||
|
Methylation in Case |
7.65E-01 (Median) | Methylation in Control | 7.79E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg05034603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.04E+00 | Statistic Test | p-value: 1.13E-02; Z-score: -1.10E-01 | ||
|
Methylation in Case |
2.66E-01 (Median) | Methylation in Control | 2.75E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in systemic lupus erythematosus | [ 11 ] | |||
|
Location |
Body (cg01924561) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.02E+00 | Statistic Test | p-value: 3.57E-02; Z-score: -1.21E-01 | ||
|
Methylation in Case |
5.62E-01 (Median) | Methylation in Control | 5.75E-01 (Median) | ||
|
Studied Phenotype |
Systemic lupus erythematosus [ ICD-11: 4A40.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Atypical teratoid rhabdoid tumor |
13 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg00737593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.66E-05; Z-score: 1.27E+00 | ||
|
Methylation in Case |
8.16E-01 (Median) | Methylation in Control | 7.36E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg01924561) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.32E+00 | Statistic Test | p-value: 1.04E-04; Z-score: 1.24E+00 | ||
|
Methylation in Case |
3.74E-01 (Median) | Methylation in Control | 2.83E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg03128534) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.18E+00 | Statistic Test | p-value: 2.53E-04; Z-score: -9.70E-01 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 8.00E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg04287330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.28E+00 | Statistic Test | p-value: 6.58E-04; Z-score: -9.07E-01 | ||
|
Methylation in Case |
4.83E-01 (Median) | Methylation in Control | 6.16E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05034603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.04E+00 | Statistic Test | p-value: 1.18E-03; Z-score: 5.54E-01 | ||
|
Methylation in Case |
8.39E-01 (Median) | Methylation in Control | 8.04E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05345039) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.33E+00 | Statistic Test | p-value: 1.38E-03; Z-score: -8.15E-01 | ||
|
Methylation in Case |
3.29E-01 (Median) | Methylation in Control | 4.36E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05802386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 1.66E-03; Z-score: -1.07E+00 | ||
|
Methylation in Case |
2.94E-01 (Median) | Methylation in Control | 3.97E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.10E+00 | Statistic Test | p-value: 1.94E-03; Z-score: 6.20E-01 | ||
|
Methylation in Case |
7.57E-01 (Median) | Methylation in Control | 6.91E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg06094523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.88E+00 | Statistic Test | p-value: 2.23E-03; Z-score: -5.24E-01 | ||
|
Methylation in Case |
6.97E-02 (Median) | Methylation in Control | 1.31E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg07499643) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.27E+00 | Statistic Test | p-value: 4.03E-03; Z-score: 1.04E+00 | ||
|
Methylation in Case |
6.72E-01 (Median) | Methylation in Control | 5.27E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg07803811) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.51E+00 | Statistic Test | p-value: 4.97E-03; Z-score: -7.21E-01 | ||
|
Methylation in Case |
1.21E-01 (Median) | Methylation in Control | 1.83E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
Body (cg09502149) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.13E+00 | Statistic Test | p-value: 1.08E-02; Z-score: 7.48E-01 | ||
|
Methylation in Case |
7.78E-01 (Median) | Methylation in Control | 6.88E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 13 |
Methylation of SLC2A1 in atypical teratoid rhabdoid tumor | [ 12 ] | |||
|
Location |
3'UTR (cg26185836) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.33E+00 | Statistic Test | p-value: 2.61E-09; Z-score: 1.42E+00 | ||
|
Methylation in Case |
2.81E-01 (Median) | Methylation in Control | 2.11E-01 (Median) | ||
|
Studied Phenotype |
Atypical teratoid rhabdoid tumor [ ICD-11: 2A00.1Y] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Lung adenocarcinoma |
10 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg15089806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.14E+00 | Statistic Test | p-value: 4.60E-04; Z-score: -2.29E+00 | ||
|
Methylation in Case |
6.48E-01 (Median) | Methylation in Control | 7.40E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg04287330) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.68E+00 | Statistic Test | p-value: 1.84E-03; Z-score: -1.82E+00 | ||
|
Methylation in Case |
8.63E-02 (Median) | Methylation in Control | 1.45E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg06094523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.15E+00 | Statistic Test | p-value: 2.15E-03; Z-score: -1.60E+00 | ||
|
Methylation in Case |
4.21E-01 (Median) | Methylation in Control | 4.82E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg26188818) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.25E+00 | Statistic Test | p-value: 2.76E-03; Z-score: -1.60E+00 | ||
|
Methylation in Case |
1.18E-01 (Median) | Methylation in Control | 1.48E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg05034603) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.23E+00 | Statistic Test | p-value: 3.91E-03; Z-score: -3.10E+00 | ||
|
Methylation in Case |
4.55E-01 (Median) | Methylation in Control | 5.58E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg05802386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.22E+00 | Statistic Test | p-value: 4.52E-03; Z-score: -1.80E+00 | ||
|
Methylation in Case |
6.80E-01 (Median) | Methylation in Control | 8.28E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg20282814) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.08E+00 | Statistic Test | p-value: 2.28E-02; Z-score: -8.67E-01 | ||
|
Methylation in Case |
7.55E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.16E+00 | Statistic Test | p-value: 2.54E-02; Z-score: -1.49E+00 | ||
|
Methylation in Case |
6.28E-01 (Median) | Methylation in Control | 7.29E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg01924561) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.12E+00 | Statistic Test | p-value: 2.65E-02; Z-score: -9.67E-01 | ||
|
Methylation in Case |
7.27E-01 (Median) | Methylation in Control | 8.15E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in lung adenocarcinoma | [ 14 ] | |||
|
Location |
Body (cg16738646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.19E+00 | Statistic Test | p-value: 4.24E-02; Z-score: -1.08E+00 | ||
|
Methylation in Case |
4.66E-01 (Median) | Methylation in Control | 5.56E-01 (Median) | ||
|
Studied Phenotype |
Lung adenocarcinoma [ ICD-11: 2C25.0] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Panic disorder |
5 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in panic disorder | [ 15 ] | |||
|
Location |
Body (cg20282814) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.11E+00 | Statistic Test | p-value: 3.81E-04; Z-score: 5.70E-01 | ||
|
Methylation in Case |
2.41E+00 (Median) | Methylation in Control | 2.18E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in panic disorder | [ 15 ] | |||
|
Location |
Body (cg22025263) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.03E+00 | Statistic Test | p-value: 8.15E-03; Z-score: 3.51E-01 | ||
|
Methylation in Case |
3.34E+00 (Median) | Methylation in Control | 3.23E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in panic disorder | [ 15 ] | |||
|
Location |
Body (cg05802386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.09E+00 | Statistic Test | p-value: 8.71E-03; Z-score: 4.30E-01 | ||
|
Methylation in Case |
2.29E+00 (Median) | Methylation in Control | 2.10E+00 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in panic disorder | [ 15 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.23E+00 | Statistic Test | p-value: 1.17E-02; Z-score: 3.76E-01 | ||
|
Methylation in Case |
8.04E-01 (Median) | Methylation in Control | 6.52E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in panic disorder | [ 15 ] | |||
|
Location |
Body (cg15089806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.08E+00 | Statistic Test | p-value: 3.09E-02; Z-score: 1.54E-01 | ||
|
Methylation in Case |
7.17E-01 (Median) | Methylation in Control | 6.62E-01 (Median) | ||
|
Studied Phenotype |
Panic disorder [ ICD-11: 6B01] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Papillary thyroid cancer |
12 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg06094523) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.35E+00 | Statistic Test | p-value: 3.06E-18; Z-score: -2.13E+00 | ||
|
Methylation in Case |
3.88E-01 (Median) | Methylation in Control | 5.23E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 2 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg09502149) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.83E+00 | Statistic Test | p-value: 1.62E-16; Z-score: -2.36E+00 | ||
|
Methylation in Case |
2.19E-01 (Median) | Methylation in Control | 4.01E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 3 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg15089806) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.21E+00 | Statistic Test | p-value: 7.70E-12; Z-score: -2.12E+00 | ||
|
Methylation in Case |
4.16E-01 (Median) | Methylation in Control | 5.06E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 4 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg01924561) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.07E-10; Z-score: -1.74E+00 | ||
|
Methylation in Case |
8.82E-01 (Median) | Methylation in Control | 9.30E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg05942022) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.09E+00 | Statistic Test | p-value: 8.37E-10; Z-score: -1.74E+00 | ||
|
Methylation in Case |
7.67E-01 (Median) | Methylation in Control | 8.35E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 6 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg05345039) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.02E+00 | Statistic Test | p-value: 1.22E-07; Z-score: 1.16E+00 | ||
|
Methylation in Case |
9.54E-01 (Median) | Methylation in Control | 9.37E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 7 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg20282814) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 3.58E-07; Z-score: -1.50E+00 | ||
|
Methylation in Case |
8.67E-01 (Median) | Methylation in Control | 9.15E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg20294984) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.07E+00 | Statistic Test | p-value: 8.31E-06; Z-score: 8.52E-01 | ||
|
Methylation in Case |
9.19E-01 (Median) | Methylation in Control | 8.59E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 9 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg05802386) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.05E+00 | Statistic Test | p-value: 4.21E-05; Z-score: -8.49E-01 | ||
|
Methylation in Case |
8.48E-01 (Median) | Methylation in Control | 8.91E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 10 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg16738646) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.26E+00 | Statistic Test | p-value: 4.65E-04; Z-score: -1.08E+00 | ||
|
Methylation in Case |
2.52E-01 (Median) | Methylation in Control | 3.18E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 11 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg00737593) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: -1.01E+00 | Statistic Test | p-value: 3.55E-02; Z-score: -3.46E-01 | ||
|
Methylation in Case |
9.11E-01 (Median) | Methylation in Control | 9.22E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 12 |
Methylation of SLC2A1 in papillary thyroid cancer | [ 16 ] | |||
|
Location |
Body (cg22025263) | ||||
|
Epigenetic Type |
Methylation | Experiment Method | Infinium HumanMethylation450 BeadChip | ||
|
Methylation Fold Change |
Fold Change: 1.06E+00 | Statistic Test | p-value: 3.68E-02; Z-score: 5.57E-01 | ||
|
Methylation in Case |
8.30E-01 (Median) | Methylation in Control | 7.84E-01 (Median) | ||
|
Studied Phenotype |
Papillary thyroid cancer [ ICD-11: 2D10.1] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Histone acetylation |
|||||
|
Mice brain |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hyperacetylation of SLC2A1 in fasted mice brain (compare with normal counterpart cells) | [ 17 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Up regulation of SLC2A1 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Mice brain | ||||
|
Experimental Material |
Model organism in vivo (mouse) | ||||
|
Additional Notes |
Fasting-induced production of the ketone body -hydroxybutyrate (-OHB) enhances expression of the glucose transporter gene Slc2a1 (Glut1) via histone modification. | ||||
|
Rat brain astrocyte |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Hypoacetylation of SLC2A1 in rat brain astrocytes (compare with valproic acid treatment counterpart cells) | [ 18 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone acetylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Down regulation of SLC2A1 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Rat brain astrocyte | ||||
|
Experimental Material |
Model organism in vivo (mouse) | ||||
|
Additional Notes |
Valproic acid could increase SLC2A1 gene expression by increasing histone acetylation at the SLC2A1 promotor. | ||||
|
Histone trimethylation |
|||||
|
Colon cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Lower level of histone trimethylation of SLC2A1 in colon cancer (compare with counterpart JMJD2B knockdown cells) | [ 19 ] | |||
|
Location |
Promoter | ||||
|
Epigenetic Type |
Histone trimethylation | Experiment Method | Chromatin immunoprecipitation | ||
|
Related Molecular Changes |
Down regulation of SLC2A1 | Experiment Method | RT-qPCR | ||
|
Studied Phenotype |
Colon cancer [ ICD-11: 2B90] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
Knockdown of JMJD2B after glucose deprivation caused decreased level of GLUT1 through increasing H3K9 tri-methylation levels on its promoter. | ||||
|
microRNA |
|||||
|
Renal cell carcinoma |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Lower expression of miR-1291 in renal cell carcinoma (compare with adjacent normal tissue) | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes |
Down regulation of SLC2A1 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-1291 | miRNA Mature ID | miR-1291 | ||
|
miRNA Sequence |
UGGCCCUGACUGAAGACCAGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Renal cell carcinoma [ ICD-11: 2C90] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
miR-1291 was down-regulated in renal cell carcinoma and regulated SLC2A1 expression via binding to the SLC2A1 mRNA. | ||||
|
Prostate cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Lower expression of miR-132 in prostate cancer (compare with adjacent normal tissue) | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes |
Down regulation of SLC2A1 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-132 | miRNA Mature ID | miR-132-3p | ||
|
miRNA Sequence |
UAACAGUCUACAGCCAUGGUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Prostate cancer [ ICD-11: 2C82] | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Additional Notes |
miR-132 was down-regulated in prostate cancer and regulated SLC2A1 expression via binding to the SLC2A1 mRNA. | ||||
|
Gastric cancer |
1 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
Lower expression of miR-148b in gastric cancer (compare with adjacent normal tissue) | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay | ||
|
Related Molecular Changes |
Down regulation of SLC2A1 | Experiment Method | RT-qPCR | ||
|
miRNA Stemloop ID |
miR-148b | miRNA Mature ID | Unclear | ||
|
miRNA Target Type |
Direct | ||||
|
Studied Phenotype |
Gastric cancer [ ICD-11: 2B72] | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Additional Notes |
miR-148b was down-regulated in gastric cancer and regulated SLC2A1 expression via binding to the SLC2A1 mRNA. | ||||
|
Unclear Phenotype |
46 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
|
Epigenetic Phenomenon 1 |
miR-1200 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1200 | miRNA Mature ID | miR-1200 | ||
|
miRNA Sequence |
CUCCUGAGCCAUUCUGAGCCUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 2 |
miR-1225 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1225 | miRNA Mature ID | miR-1225-3p | ||
|
miRNA Sequence |
UGAGCCCCUGUGCCGCCCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 3 |
miR-1262 directly targets SLC2A1 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-1262 | miRNA Mature ID | miR-1262 | ||
|
miRNA Sequence |
AUGGGUGAAUUUGUAGAAGGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 4 |
miR-1291 directly targets SLC2A1 | [ 20 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-1291 | miRNA Mature ID | miR-1291 | ||
|
miRNA Sequence |
UGGCCCUGACUGAAGACCAGCAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 5 |
miR-1296 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1296 | miRNA Mature ID | miR-1296-5p | ||
|
miRNA Sequence |
UUAGGGCCCUGGCUCCAUCUCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 6 |
miR-132 directly targets SLC2A1 | [ 21 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Luciferase reporter assay//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-132 | miRNA Mature ID | miR-132-3p | ||
|
miRNA Sequence |
UAACAGUCUACAGCCAUGGUCG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 7 |
miR-148b directly targets SLC2A1 | [ 22 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | Immunohistochemistry//In situ hybridization//Luciferase reporter assay//qRT-PCR//Western blot | ||
|
miRNA Stemloop ID |
miR-148b | miRNA Mature ID | miR-148b-3p | ||
|
miRNA Sequence |
UCAGUGCAUCACAGAACUUUGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Patient tissue samples | ||||
|
Epigenetic Phenomenon 8 |
miR-149 directly targets SLC2A1 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-149 | miRNA Mature ID | miR-149-5p | ||
|
miRNA Sequence |
UCUGGCUCCGUGUCUUCACUCCC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 9 |
miR-1538 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-1538 | miRNA Mature ID | miR-1538 | ||
|
miRNA Sequence |
CGGCCCGGGCUGCUGCUGUUCCU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 10 |
miR-1914 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-1914 | miRNA Mature ID | miR-1914-5p | ||
|
miRNA Sequence |
CCCUGUGCCCGGCCCACUUCUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 11 |
miR-214 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-214 | miRNA Mature ID | miR-214-5p | ||
|
miRNA Sequence |
UGCCUGUCUACACUUGCUGUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 12 |
miR-2909 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-2909 | miRNA Mature ID | miR-2909 | ||
|
miRNA Sequence |
GUUAGGGCCAACAUCUCUUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 13 |
miR-3064 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3064 | miRNA Mature ID | miR-3064-5p | ||
|
miRNA Sequence |
UCUGGCUGUUGUGGUGUGCAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 14 |
miR-3135b directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3135b | miRNA Mature ID | miR-3135b | ||
|
miRNA Sequence |
GGCUGGAGCGAGUGCAGUGGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 15 |
miR-3184 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-3184 | miRNA Mature ID | miR-3184-3p | ||
|
miRNA Sequence |
AAAGUCUCGCUCUCUGCCCCUCA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 16 |
miR-324 directly targets SLC2A1 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-324 | miRNA Mature ID | miR-324-3p | ||
|
miRNA Sequence |
CCCACUGCCCCAGGUGCUGCUGG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 17 |
miR-3652 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-3652 | miRNA Mature ID | miR-3652 | ||
|
miRNA Sequence |
CGGCUGGAGGUGUGAGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 18 |
miR-4267 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4267 | miRNA Mature ID | miR-4267 | ||
|
miRNA Sequence |
UCCAGCUCGGUGGCAC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 19 |
miR-4268 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4268 | miRNA Mature ID | miR-4268 | ||
|
miRNA Sequence |
GGCUCCUCCUCUCAGGAUGUG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 20 |
miR-4323 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4323 | miRNA Mature ID | miR-4323 | ||
|
miRNA Sequence |
CAGCCCCACAGCCUCAGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 21 |
miR-4324 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4324 | miRNA Mature ID | miR-4324 | ||
|
miRNA Sequence |
CCCUGAGACCCUAACCUUAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 22 |
miR-4430 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4430 | miRNA Mature ID | miR-4430 | ||
|
miRNA Sequence |
AGGCUGGAGUGAGCGGAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 23 |
miR-4434 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4434 | miRNA Mature ID | miR-4434 | ||
|
miRNA Sequence |
AGGAGAAGUAAAGUAGAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 24 |
miR-4448 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-4448 | miRNA Mature ID | miR-4448 | ||
|
miRNA Sequence |
GGCUCCUUGGUCUAGGGGUA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 25 |
miR-4505 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4505 | miRNA Mature ID | miR-4505 | ||
|
miRNA Sequence |
AGGCUGGGCUGGGACGGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 26 |
miR-4516 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4516 | miRNA Mature ID | miR-4516 | ||
|
miRNA Sequence |
GGGAGAAGGGUCGGGGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 27 |
miR-4531 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4531 | miRNA Mature ID | miR-4531 | ||
|
miRNA Sequence |
AUGGAGAAGGCUUCUGA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 28 |
miR-4638 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4638 | miRNA Mature ID | miR-4638-5p | ||
|
miRNA Sequence |
ACUCGGCUGCGGUGGACAAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 29 |
miR-4745 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4745 | miRNA Mature ID | miR-4745-3p | ||
|
miRNA Sequence |
UGGCCCGGCGACGUCUCACGGUC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 30 |
miR-4747 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-4747 | miRNA Mature ID | miR-4747-3p | ||
|
miRNA Sequence |
AAGGCCCGGGCUUUCCUCCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 31 |
miR-484 directly targets SLC2A1 | [ 26 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
|
miRNA Stemloop ID |
miR-484 | miRNA Mature ID | miR-484 | ||
|
miRNA Sequence |
UCAGGCUCAGUCCCCUCCCGAU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
|
Epigenetic Phenomenon 32 |
miR-5008 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5008 | miRNA Mature ID | miR-5008-3p | ||
|
miRNA Sequence |
CCUGUGCUCCCAGGGCCUCGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 33 |
miR-544b directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-544b | miRNA Mature ID | miR-544b | ||
|
miRNA Sequence |
ACCUGAGGUUGUGCAUUUCUAA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 34 |
miR-5586 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-5586 | miRNA Mature ID | miR-5586-5p | ||
|
miRNA Sequence |
UAUCCAGCUUGUUACUAUAUGC | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 35 |
miR-5703 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5703 | miRNA Mature ID | miR-5703 | ||
|
miRNA Sequence |
AGGAGAAGUCGGGAAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 36 |
miR-5787 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-5787 | miRNA Mature ID | miR-5787 | ||
|
miRNA Sequence |
GGGCUGGGGCGCGGGGAGGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 37 |
miR-6504 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6504 | miRNA Mature ID | miR-6504-5p | ||
|
miRNA Sequence |
UCUGGCUGUGCUGUAAUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 38 |
miR-6514 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6514 | miRNA Mature ID | miR-6514-3p | ||
|
miRNA Sequence |
CUGCCUGUUCUUCCACUCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 39 |
miR-6737 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6737 | miRNA Mature ID | miR-6737-3p | ||
|
miRNA Sequence |
UCUGUGCUUCACCCCUACCCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 40 |
miR-6761 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6761 | miRNA Mature ID | miR-6761-5p | ||
|
miRNA Sequence |
UCUGAGAGAGCUCGAUGGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 41 |
miR-6772 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6772 | miRNA Mature ID | miR-6772-3p | ||
|
miRNA Sequence |
UUGCUCCUGACUCUGUGCCCACA | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 42 |
miR-6811 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6811 | miRNA Mature ID | miR-6811-3p | ||
|
miRNA Sequence |
AGCCUGUGCUUGUCCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 43 |
miR-6842 directly targets SLC2A1 | [ 25 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | PAR-CLIP | ||
|
miRNA Stemloop ID |
miR-6842 | miRNA Mature ID | miR-6842-3p | ||
|
miRNA Sequence |
UUGGCUGGUCUCUGCUCCGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Human breast adenocarcinoma cell line (MCF-7) | ||||
|
Epigenetic Phenomenon 44 |
miR-6870 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6870 | miRNA Mature ID | miR-6870-3p | ||
|
miRNA Sequence |
GCUCAUCCCCAUCUCCUUUCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 45 |
miR-6882 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-6882 | miRNA Mature ID | miR-6882-3p | ||
|
miRNA Sequence |
UGCUGCCUCUCCUCUUGCCUGCAG | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
|
Epigenetic Phenomenon 46 |
miR-7157 directly targets SLC2A1 | [ 24 ] | |||
|
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
|
miRNA Stemloop ID |
miR-7157 | miRNA Mature ID | miR-7157-3p | ||
|
miRNA Sequence |
UCUGUGCUACUGGAUGAAGAGU | ||||
|
miRNA Target Type |
Direct | ||||
|
Experimental Material |
Multiple cell lines of human | ||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.