Detail Information of Epigenetic Regulations
General Information of Drug Transporter (DT) | |||||
---|---|---|---|---|---|
DT ID | DTD0253 Transporter Info | ||||
Gene Name | SLC2A11 | ||||
Transporter Name | Glucose transporter type 11 | ||||
Gene ID | |||||
UniProt ID | |||||
Epigenetic Regulations of This DT (EGR) | |||||
---|---|---|---|---|---|
microRNA |
|||||
Unclear Phenotype |
22 Epigenetic Phenomena Related to This Phenotype | Click to Show/Hide the Full List | |||
Epigenetic Phenomenon 1 |
let-7e directly targets SLC2A11 | [ 1 ] | |||
Epigenetic Type |
microRNA | Experiment Method | CLASH | ||
miRNA Stemloop ID |
let-7e | miRNA Mature ID | let-7e-5p | ||
miRNA Sequence |
UGAGGUAGGAGGUUGUAUAGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Human embryonic kidney 293 cells (HEK293) | ||||
Epigenetic Phenomenon 2 |
miR-129 directly targets SLC2A11 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-129 | miRNA Mature ID | miR-129-5p | ||
miRNA Sequence |
CUUUUUGCGGUCUGGGCUUGC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 3 |
miR-181b directly targets SLC2A11 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-181b | miRNA Mature ID | miR-181b-3p | ||
miRNA Sequence |
CUCACUGAACAAUGAAUGCAA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 4 |
miR-3157 directly targets SLC2A11 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3157 | miRNA Mature ID | miR-3157-5p | ||
miRNA Sequence |
UUCAGCCAGGCUAGUGCAGUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 5 |
miR-335 directly targets SLC2A11 | [ 5 ] | |||
Epigenetic Type |
microRNA | Experiment Method | Microarray | ||
miRNA Stemloop ID |
miR-335 | miRNA Mature ID | miR-335-5p | ||
miRNA Sequence |
UCAAGAGCAAUAACGAAAAAUGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 6 |
miR-3529 directly targets SLC2A11 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3529 | miRNA Mature ID | miR-3529-5p | ||
miRNA Sequence |
AGGUAGACUGGGAUUUGUUGUU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 7 |
miR-3606 directly targets SLC2A11 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-3606 | miRNA Mature ID | miR-3606-3p | ||
miRNA Sequence |
AAAAUUUCUUUCACUACUUAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 8 |
miR-379 directly targets SLC2A11 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-379 | miRNA Mature ID | miR-379-5p | ||
miRNA Sequence |
UGGUAGACUAUGGAACGUAGG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 9 |
miR-4420 directly targets SLC2A11 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4420 | miRNA Mature ID | miR-4420 | ||
miRNA Sequence |
GUCACUGAUGUCUGUAGCUGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 10 |
miR-4438 directly targets SLC2A11 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4438 | miRNA Mature ID | miR-4438 | ||
miRNA Sequence |
CACAGGCUUAGAAAAGACAGU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 11 |
miR-4451 directly targets SLC2A11 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4451 | miRNA Mature ID | miR-4451 | ||
miRNA Sequence |
UGGUAGAGCUGAGGACA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 12 |
miR-4650 directly targets SLC2A11 | [ 2 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4650 | miRNA Mature ID | miR-4650-3p | ||
miRNA Sequence |
AGGUAGAAUGAGGCCUGACAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Left ventricular cardiac tissues of human | ||||
Epigenetic Phenomenon 13 |
miR-4691 directly targets SLC2A11 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4691 | miRNA Mature ID | miR-4691-3p | ||
miRNA Sequence |
CCAGCCACGGACUGAGAGUGCAU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 14 |
miR-4711 directly targets SLC2A11 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4711 | miRNA Mature ID | miR-4711-5p | ||
miRNA Sequence |
UGCAUCAGGCCAGAAGACAUGAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 15 |
miR-4742 directly targets SLC2A11 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-4742 | miRNA Mature ID | miR-4742-3p | ||
miRNA Sequence |
UCUGUAUUCUCCUUUGCCUGCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 16 |
miR-5189 directly targets SLC2A11 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-5189 | miRNA Mature ID | miR-5189-3p | ||
miRNA Sequence |
UGCCAACCGUCAGAGCCCAGA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 17 |
miR-649 directly targets SLC2A11 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-649 | miRNA Mature ID | miR-649 | ||
miRNA Sequence |
AAACCUGUGUUGUUCAAGAGUC | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 18 |
miR-6504 directly targets SLC2A11 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6504 | miRNA Mature ID | miR-6504-3p | ||
miRNA Sequence |
CAUUACAGCACAGCCAUUCU | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 19 |
miR-653 directly targets SLC2A11 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-653 | miRNA Mature ID | miR-653-3p | ||
miRNA Sequence |
UUCACUGGAGUUUGUUUCAAUA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 20 |
miR-6765 directly targets SLC2A11 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6765 | miRNA Mature ID | miR-6765-3p | ||
miRNA Sequence |
UCACCUGGCUGGCCCGCCCAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 21 |
miR-6890 directly targets SLC2A11 | [ 3 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-6890 | miRNA Mature ID | miR-6890-3p | ||
miRNA Sequence |
CCACUGCCUAUGCCCCACAG | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Epigenetic Phenomenon 22 |
miR-7151 directly targets SLC2A11 | [ 4 ] | |||
Epigenetic Type |
microRNA | Experiment Method | HITS-CLIP | ||
miRNA Stemloop ID |
miR-7151 | miRNA Mature ID | miR-7151-3p | ||
miRNA Sequence |
CUACAGGCUGGAAUGGGCUCA | ||||
miRNA Target Type |
Direct | ||||
Experimental Material |
Multiple cell lines of human | ||||
Methylation |
|||||
If you find any error in data or bug in web service, please kindly report it to Dr. Yin and Dr. Li.